TABLE 1.

Predicted miRNA sequences of HCMVa

Stem-loopConservation score vs CCMVMiRscan scoreNucleotide coordinates of stem-loopRelative genome positionPredicted miR
UL22-16410.27C 27639 to 27716Between UL22-UL23UCACGGGAAGGCUAGUUAGAC
UL31-18011.80C 39176 to 39258A/S UL31CGGCAUGUUGCGCGCCGUGAU
UL36-18712.85C 49502 to 49563UL36 intronAGACACCUGGAAAGAGGACGU
UL53-19012.24C 77054 to 77134A/S UL53UGCGCGAGACCUGCUCGUUGC
UL54-18212.57C 79184 to 79276UL54UGCGCGUCUCGGUGCUCUCGG
UL70-18410.28104018 to 104083A/S UL70UGCGUCUCGGCCUCGUCCAGA
UL102-18713.39148054 to 148113UL102UGGCCAUGUCGUUUCGCGUCG
UL102-28212.95C 148703 to 148767A/S UL102UGGCGUCGUCGCUCGGCGGGU
UL111a-19314.64161368 to 161436Between UL111a-UL112/113UGACGUUGUUUGUGGGUGUUG
US4-17312.86196080 to 196163Partial US4CGACAUGGACGUGCAGGGGGA
US5-16214.77196991 to 197056Between US6-US7UGACAAGCCUGACGAGAGCGU
US5-28310.49197120 to 197184Between US6-US7UGAUAGGUGUGACGAUGUCUU
US29-18915.43221396 to 221479US29UUGGAUGUGCUCGGACCGUGA
  • a For each of the 13 identified candidate miRNA stem-loop sequences, the nucleotide coordinates and genome positions relative to the annotated ORFs of HCMV (AD169) are shown. The percentage conservation compared to CCMV and the overall MiRscan score are also indicated along with the predicted miRNA sequence. C, complementary strand; A/S, antisense to ORF shown.