TABLE 2.

List of primers for area UL80-82a

PrimerSequence (5′→3′)
UL81 F1AGCACGCCGCACTACGACCTA
UL81 F2CCGCGGCAGACATCAGCA
UL81 R1GACGCTATATTTAGGGCTTCC
UL81 R2GGAAAAACACGCGGGGGA
UL81 R3GTGCTGGAAGTGGAAGCGG
UL82 F1ATGACCTCTCCTCCACACC
UL82 F2GAGCCTTGACGACTTGGTAC
UL80 F1AGCAGCAGCAACAACGTTAC
UL80 R1GGAAGAAGAACCTGCCGTCG
UL80 F2GCGGCAGAGTTCTACGTTAC
UL80 R2TTGGCACCTCCGGATAGAAG
UL82n F1AAGATGGTGTCGTGAGTCTG
UL82n R1TGACCGTAACGCCGAACTGG
UL82n F2CATTCTGGATCTGCACGATG
UL82n R2AACGGAGACGGACGAACGAG
  • a For genes UL80 and UL82n, nested PCR was done in all cases with primers F1 and R1 in the first amplification and F2-R2 in the second.