TABLE 1.

List of primers

PrimerSequence (5′→3′)
This study
    β-Actin RTGGCTACAGCTTCACCACC
    β-Actin FACTCCTGCTTGCTGATCCAC
    ZapRGTAAAACGACGGCCAGT
    ZapFGGAAACAGCTATGACCATG
    APGGCACGCGTCGACTAGTACT (17T total)
    UAPCUAGGCCACGCGTCGACTAGTAC
IE-1 primers
    IEP 4BIICAATACACTTCATCTCCTCGAAAGG
    IEP 2AIIATGGAGTCCTCTGCCAAGAGAAAGATGGAC
    IEP 3AGTGACCAAGGCCACGACGTT
    IEP 3BTCTGCCAGGACATCTTTCTC
Previously described latency gene primers (18, 22)
    Anti-CLT FACTCATGGTCGCTCGGCAGCTCCTTGCTC
    Anti-CLT RGCACAAACCCCGACACGTACCGTGGCA
    CLT F1TAGTCTGCAGGAACGTCGTGGCCTTGGT
    CLT F2TCGTCAGGATTATCAGGGTCCATCTTTCTCT
    CLT F2a2GGAAGGGCCCTCGTCAGGATTATCAGGGTC
    CLT R1TACATCAATGGGCGTGGATAGCGGTTTGAC
    CLT R2AAATGGGCGGTAGGCGTGTACGGTGG
    CLT R2-2GTATCATATGCCAAGTACGCC
UL82as protein cloning primers
    TOPO-UL82as FCACCATGACGAGCGTGAGAGCCC
    UL82as RTTTGGAACACCGACAGCCG