TABLE 1.

Sequences inserted at the 3′ end of the minigenome Le region

MinigenomeSequence of 3′-terminal extensiona
+4 UGCC b
+5 UGCCA
+6 UGCCAA
+7 UGCCAAU
+8 UGCCAAUA
+9 UGCCAAUAG
+14 UGCCAAUAGUGUUU
+25 UGCCUUAGAUAACUCAAUAGUGUUU
+56 UGCCUAGGUCGUUGUUUGUUAGCUCGGUCUUCUCUUGAUGGUUCCAAAUACUUAGG
+56(11) UGCCCUUUUUUCCUAGGGUUAGCUCGGUCUUCUCUUGAUGGUUCCAAAUACUUAGG
+56(13) UGCCCUUUUUUACCCUAGGUAGCUCGGUCUUCUCUUGAUGGUUCCAAAUACUUAGG
+56(13)Nsic UGCCCUUUUUUACCCUAGGUAGCUCGGUCUUCUCUUGAUGGUUCCAAAUACgUAGG
3Aextd UG A CCUUUUUUACCCUAGGUAGCUCGGUCUUCUCUUGAUGGUUCCAAAUACgUAGG
+13 only UGCCCUUUUUUACCCUAGGUAGCUCGGUCUUCUCUUGAUGGUUCCAAAUACUUAGG
+56(35) UGCCCUUUUUUACGCAUGUUGUUUGAACGUAUUUGCCUAGGUUCCAAAUACUUAGG
+56(44) UGCCCUUUUUUACGCAUGUUGUUUGAACGUAUUUGGUUUUUUUACCUAGGCUUAGG
Wild typee UGCCCUUUUUUACGCAUGUUGUUUGAACGUAUUUGGUUUUUUUA CCCCGUUUAUUC
  • a The sequence is shown 3′ to 5′ as negative-sense RNA.

  • b Nucleotides that share identity with the corresponding position in wild-type Le are shown in bold type.

  • c The U-to-G substitution to introduce an NsiI site in the plasmid cDNA is in lowercase.

  • d The C-to-A substitution at position 3 is underlined.

  • e The sequence at the 3′ terminus of wild-type RSV is shown for comparison, with the Le sequence in bold type and the gene start sequence in italics.