TABLE 2.

Primers

NameSequence (5′-3′)aFunction
HL38GGAAGAGGAATCCTGGCUpstream of XhoI in fusion PCR for introducing alanine mutations
HL39CCAATTGCTTCCAGTCTTTGDownstream of AvrII in fusion PCR for introducing alanine mutations
HL495GCTTTAATCAGAGGATCCATGAAAAACTCATCACAGAAAAGAATTUpstream primer for generating Gag in GST vector
HL496AGTTAGCACAAGGATACCCTCGAGTCAATAACGTCTTTTCTTGTATTTTGTADownstream primer for generating Gag in GST vector
HL815ATTCGAGCTGCCGCAGCGGGTGGATATTGTACTCAATop-strand primer for mutant A1
HL816TCCACCCGCTGCGGCAGCTCGAATTCTTTTCTGTGATGBottom-strand primer for mutant A1
HL817GGAAATGCTGCCGCAGCGACTCAAGATGATATTTCAGATop-strand primer for mutant A2
HL818TTGAGTCGCTGCGGCAGCATTTCCATCCATTCGAATTCBottom-strand primer for mutant A2
HL871TATTGTGCTGCCGCAGCGATTTCAGATATCCTTAAGCATop-strand primer for mutant A3
HL872TGAAATCGCTGCGGCAGCACAATATCCACCATTTCCATBottom-strand primer for mutant A3
HL821GATGATGCTGCCGCAGCGCTTAAGCATTTTGTAAATCAATop-strand primer for mutant A4
HL822CTTAAGCGCTGCGGCAGCATCATCTTGAGTACAATATCBottom-strand primer for mutant A4
HL823GATATCGCTGCCGCAGCGGTAAATCAAACCACCCGCCATTop-strand primer for mutant A5
HL824TTACCGCTGCGGCAGCGATATCTGAAATATCATCTTGAGBottom-strand primer for mutant A5
HL878-1TCCGCGGATCCGTAAATCAAACCACCCGCCATGTGGAAATop-strand primer for Δ30 Gag
HL1061GTTTAATCCGCGGATCCATGAAAAACTCATCACAGAAUpstream primer for generating Gag segment 1-50 fusion in GST vector
HL1062GTTTAATCCGCGGATCCATCGTTAAATTAAGAACATTTUpstream primer for generating Gag segment 50-100 fusion in GST vector
HL1063GTTTAATCCGCGGATCCTGGGATGAACTATTAAGAAGAATUpstream primer for generating Gag segment 100-150 fusion in GST vector
HL1064GTTTAATCCGCGGATCCTTATATCTACTATGGATGCTTUpstream primer for generating Gag segment 150-200 fusion in GST vector
HL1065GTTTAATCCGCGGATCCTTAAAAACAAAGACTGGAAGCUpstream primer for generating Gag segment 200-250 fusion in GST vector
HL1066ACAAGGATCCGCTCGAGTCAGAACTCTTCCATATCCATGCDownstream primer for generating Gag 1-50 segment fusion in GST vector
HL1067ACAAGGATCCGCTCGAGTCAATCCCAAGTAAGAGAAGAATDownstream primer for generating Gag 50-100 segment fusion in GST vector
HL1068ACAAGGATCCGCTCGAGTCAAATCTGACTCGTTTCTCACTDownstream primer for generating Gag 100-150 segment fusion in GST vector
HL1069ACAAGGATCCGCTCGAGTCAAAAAGATTCCTAGGTTTGGTDownstream primer for generating Gag 150-200 segment fusion in GST vector
HL1070ACAAGGATCCGCTCGAGTCACATTTCATAACGTCTTTTCTTDownstream primer for generating Gag 200-250 segment fusion in GST vector
  • a Underlined sequences indicate sites of mutations.