TABLE 1.

PCR primer sequences with HXB2 locations and annealing temperatures for regions 1, 2, and 3

Target or primer setPrimer name (reference)Sequence (5′-3′)HXB2 numberingTanneal (°C)
gag/pol (region 1)
    outer primer pair 1F2NST (25)→ GCGGAGGCTAGAAGGAGAGAGATGG769-79358
SP3AS← CCTCCAATTCCCCCTATCATTTTTGG2382-2407
    outer primer pair 2MSF12B (25)→ AAATCTCTAGCAGTGGCGCCCGAACAG623-64958
BJPOL3 (31)← GTTGACAGGTGTAGGTCCTAC2481-2501
    Inner primer pair 1MHGAG1 (11)→ AGTATGGGCAAGCAGGGA891-90855
MHPOL4 (11)← TGCCAAAGAGTGATTTGAGG2253-2272
    inner primer pair 2DD→ GTATGGGCAAGCAGGGAGCTAGAA892-91555
MHPOL2 (11)← ACTGTATCATCTGCTCCTGT2328-2347
vpu/gp120 (region 2)
    outer primer pair 1MHVPU1 (11)→ CCTATGGCAGGAAGAAGCGG5967-598652
GP120 3′ (22)← AGTGCTTCCTGCTGCTCC7794-7811
    outer primer pair 2ED3→ TTAGGCATCTCCTATGGCAGGAAGAAGCGG5957-598660
AA1570 (3)← GCCCATAGTGCTTCCTGCTGCTCC7794-7817
    inner primer pair 1MHVPU3 (11)→ GCAGAAGAYAGTGGCAATGAG6209-622954
EDS8← CACTTCTCCAATTGTCCCTCA7648-7668
    inner primer pair 2GP120 5′ (22)→ AGAGCAGAAGACAGTGGCAATGA6206-622854
AA1400 (3)← TTTCCTCCTCCAGGTCTGAAG7625-7645
gp41/nef (region 3)
    outer primer pair 1AES9→ GAGGGACAATTGGAGAAGTG7649-766860
JL90← GTGTGTGGTAGACCCACAGATCAAGGAT9121-9148
    outer primer pair 2AES9→ GAGGGACAATTGGAGAAGTG7649-766860
JL89 (21)← TCCAGTCCCCCCTTTTCTTTTAAAAA9064-9089
    inner primer pair 1JL110.ta→ GGGCAAAGAGAAGAGTGGTG7723-774260
JL90← GTGTGTGGTAGACCCACAGATCAAGGAT9121-9148
    inner primer pair 2ZKF→ GTGGGAATAGGAGCTGTGTTCCTTGGG7761-778760
JL88.ta← GTCATTGGTCTTAAAGGTACCTG9013-9035