TABLE 2.

Nucleotide sequences of PCR primers

GenePrimer sequencesProduct (bp)Accession no.
HSV-1
    VHStgctacattcccacgatcaa, aggtcctcgtcgtcttcgta346AF007815
    ICP0acagacccccaacacctaca, gcgtatgagtcagtgggga150AF431736
    ICP27ccctttctccagtgctacctgaa, gtgcgtgtctaggatttcgatc256
    LATttggcggtaaccccgattgtttatctcagg & tcgttccgtcgccgggatgtttcgttcgt200
Human
    IFN-αagaatctctcctttctcctg, tctgacaacctcccaggcaca369
    IFN-α6ctggactgtgatctgcctca, cttcagccttctggaactgg169gi:11128014
    IFN-α5ccagttccagaagg ctcaag, tgtcttccactccaacctcc197gi:4504596
    IFN-βtgggaggattctgcattacc, cagcatctgctggttgaaga200gi:4504602
    IFN-γtgaccagagcatccaaaaga, atattgcaggcaggacaacc280gi:10835170
Mouse
    IFN-αtctcctgcctgaaggacagg, gagcagaagtctgga320
    IFN-αBtggcagtgatgagctactgg, atctgctgggtcagctcagt240gi:6680370
    IFN-α14tgctggtgatgagctactgg, gagccttcttgatctgctgg200gi:29468971
    IFN-α4ctggtcagcctgttctctaggatgt, tcagaggaggttcctgcatcac314
    IFN-βccctatggagatga cggaga, tcccacgtcaatctttcctc222gi:6754303
    IFN-γgaaaaggag tcgctgctgat, agatacaaccccgcaatcac319gi:2850152
    p53gtaccttatgagccacccga, ctgtagcatgggcatccttt446gi:6755880
β-Actingtggggcgccccaggcacca, ctccttaatgtcacgcacgatttc550
  • a The primers directed against glycoprotein C (gC), β-actin, and LAT were described previously (41). The human IFN-α primer that amplifies all human subtypes of IFN-α was described previously (34). The mouse IFN-α primer that amplifies all human subtypes of IFN-α was designed based on the consensus sequence of the respective IFN-α subtypes in mice. The mouse IFN-α4 primers were described previously (65). All primers are presented in a 5′-to-3′ direction. The first primer is the forward primer and the second is the reverse primer.