TABLE 2.

Primer sequences positive for Bat-CoV detection

PCRTarget sequencePrimer orientationPrimer sequence (5′ to 3′)
1RdRpForwardAYAACCAAGATCTTAATGG
ReverseTGCTTAGAACCCAAAATCAT
2aRdRpForwardGGTTGGGACTATCCTAAGTGTGA
ReverseCCATCATCAGATAGAATCATCATA
3Helicase-ExoNForwardCTCARGGTAGTGARTATGA
ReverseAATTGTTCWCCWGGTGG
4SpikeForwardWTATGTTTGYAATGGTAAY
ReverseGTCWTCATCMACWGTRC
5SpikeForwardGAYTDDCAGCACTTAATGC
ReverseTTGAGCCAYTCAAGRTYRA
6SpikeForwardCAATCTAGGTCTGCTATCG
ReverseCTAGAAGACTGTGATTTGA
  • a Forward and reverse primers (IN-6 and IN-7) were communicated through the World Health Organization's SARS etiology network by colleagues from the Centers for Disease Control and Prevention.