TABLE 1.

Oligonucleotides used for site-directed mutagenesis

MutantOligonucleotideaOligonucleotide sequence 5′→3′b
TRS-S1S1-Bmg VS2GGACGTCACGTCCATTAAAAGTTGCTCATTAGAAATAATGG
S1-Blpl RSGTCCGGCGCTAAGCTCATGGTGTGTTAACGAAGTGG
TRS-S2wtS2-Bmg VS2GGACGTCACGTCCATTAAAACCAGTGGAATCTCATTGAAAC
S2-Blpl RSGTCCGGCGCTAAGCATCTGAATTAGGTGGTAACCTAC
M1S2-Bmg 5′A VSGGACGTCACGTCCATTAAAACCAGTGGAATCTCATTGAAACCTTCCTACTAAAC
M2S2-Bmg 5′AA VSGGACGTCACGTCCATTAAAACCAGTGGAATCTCATTGAAACCTTCCAACTAAAC
M3S2-Bmg 5′GAA VSGGACGTCACGTCCATTAAAACCAGTGGAATCTCATTGAAACCTTGGAACTAAAC
M4S2-Bmg 5′CGAA VSGGACGTCACGTCCATTAAAACCAGTGGAATCTCATTGAAACCTTCGAACTAAAC
M5S2-Blpl 3′G RSGTCCGGCGCTAAGCATCTGAATTAGGTGGTAACCTACTACTAGCGTTTAG
M6S2-Blpl 3′GA RSGTCCGGCGCTAAGCATCTGAATTAGGTGGTAACCTACTACTATCGTTTAG
M7S2-Blpl 3′GAA RSGTCCGGCGCTAAGCATCTGAATTAGGTGGTAACCTACTACGTTCGTTTAG
M8S2-Blpl 3′GAAA RSGTCCGGCGCTAAGCATCTGAATTAGGTGGTAACCTACTACTTTCGTTTAG
M9S2-Bmg CGAA + GA VSGGACGTCACGTCCATTAAAACCAGTGGAATCTCATTGAAACCTTCGAACTAAACGATAG
M10S2-Bmg CGAA + GAAA VSGGACGTCACGTCCATTAAAACCAGTGGAATCTCATTGAAACCTTCGAACTAAACGAAAGTA
  • a Oligonucleotides used to introduce the mutations begin with “S2” and indicate the restriction site included, the nucleotide substitutions, and the position of the substitutions 5′ or 3′ of the CS.

  • b The mutated nucleotides are shown in boldface. Restriction endonuclease sites used for cloning are underlined (BmgBI, CACGTC; BlpI, GCTAAGC).