TABLE 2.

Coding potential and putative transcription regulatory sequences of the CoV-HKU1 genome sequence

ORFStart to end (nucleotide position)No. of nucleotidesNo. of amino acidsFramePutative TRS
Nucleotide position in genomeTRS sequencea
ORF 1a206-1360013,3954,465+263UUAAAUCUAAACUUUUUAA (127) AUG
ORF 1b13600-217538,1542,717+1
ORF 2 (HE)21773-229331,161386+221763UUAAAUCUAAACUAUG
ORF 3 (S)22942-270124,0711,356+122933UUAAAUCUAAACAUG
ORF 427051-27380330109+327035UUAAAUCUAAACUUUAUUUAUG
ORF 5 (E)27373-2762124982+1
ORF 6 (M)27633-28304672223+327621CUAAAUCUAAACAUUAUG
ORF 7 (N)28320-296451,326441+328304UUAAAUCUAAACUAUUAGGAUG
ORF 828342-28959618205+128304UUAAAUCUAAACUAUUAGGAUGUCUUAUACUCCCGGUCAUUAUG
  • a Boldface type indicates putative initiation codon. Underlining indicates core sequence of TRS motif identical to the 3′ end of the leader sequence.