TABLE 1.

Primers used to amplify cDNAa

GenePrimer (type)bPCR product(s) (bp)Melting tempNo. of cyclesGeneBank accession no.
Bcl-2GTCGCTACCGTCGTGACTT (F)2676035NM 009741
CAGCCTCCGTTATCCTGGA (R)
Bcl-xCCAGCTTCACATAACCCAG (F)250, 64c6030-35L35049
ATCCACAAAAGTGTCCCAGC (R)
Casp 9AAGACCATGGCTTTGAGGTG (F)3336035AB01960
AACAGCCAGGAATCTGCTTG (R)
β-actinGTGGGGCGCCCCAGGCACCA (F)4005320
C TCCTTAATGTCACGCACGATTTC (R)
VHSTGCTACATTCCCACGATCAA (F)3466030AF007815
AGGTCCTCGTCGTCTTCGTA (R)
gCAGGTCCTGACGAACATCACC (F)2086030JO2216
TAATACATTCCCTGGGTCGC (R)
BakTTGCCCAGGACACAGAGGAGGT (F)5276040AF402617
GAATTGGCCCAACAGAACCACACC (R)
  • a The melting temperatures of the respective primers and the numbers of cycles used for PCR are given for each primer pair.

  • b Forward (F) and reverse (R) primers were designed on the basis of the sequences of the respective genes. All primers are listed in a 5′ to 3′ direction.

  • c The Bcl-x primers can amplify a 250-bp cDNA product (Bcl-xL) and a 64-bp cDNA product (Bcl-xS).