TABLE 1.

Sequences of the primers used to detect the expression of the coding envelopes by quantitative RT-PCR analysis

GenePrimers sequence (5′-3′)
envH1F: TTCACTCCATCCTTGGCTAT
R: CGTCGAGTATCTACGAGCAAT
envH2F: ACTACACACATCACTGAAACAAA
R: GGATGGAGTGAAATACAGGAC
envH3F: CCCTCCTCCACATTTATTTG
R: GTTGGGCTTTGGAGATGG
envKF: CACAACTAAAGAAGCTGACG
R: CATAGGCCCAGTTGGTATAG
envTF: CCAGGATTTGATGTTGGG
R: GGGGTGAGGTTAAGGAGATGG
envWF: CCCCATCGTATAGGAGTCTT
R: CCCCATCAGACATACCAGTT
envFRDF: GCCTGCAAATAGTCTTCTTT
R: ATAGGGGCTATTCCCATTAG
envRF: CCATGGGAAGCAAGGGAACT
R: CTTTCCCCAGCGAGCAATAC
envR(b)F: GGACAGTGCCGACATACTAT
R: TAGAGTGCAGCATCCTAACC
envF(c)2F: ATGGAGGACTATATGAGCACAA
R: ATTAAAGTTAACCACGAGAAGC
envF(c)1F: GGGCCACTAAGTTACTAGGTC
R: AGTTAGGAGGGAGTTACTGGG