TABLE 1.

Primer and probe sequences

Primer or probecSequence (5′-3′)Target
MH 531TGTGTGCCCGTCTGTTGTGTTotal HIV-1 DNA
MH 532GAGTCCTGCGTCGAGAGAGC
MH FL*CCCTCAGACCCTTTTAGTCAGTGTGGAAa
MH LC*TCTCTAGCAGTGGCGCCCGAACAGb
HIV FGTGCCCGTCTGTTGTGTGACTTwo-LTR circle
HIV R1ACTGGTACTAGCTTGTAGCACCATCCA
HIV FL*CCACACACAAGGCTACTTCCCTGAa
HIV LC*TGGCAGAACTACACACCAGGGCb
L-M667ATGCCACGTAAGCGAAACTCTGGCTAACTAGGGAACCCACTGIntegrated HIV-1 DNA (first-round PCR)
Alu 1TCCCAGCTACTGGGGAGGCTGAGG
Alu 2GCCTCCCAAAGTGCTGGGATTACAG
Lambda TATGCCACGTAAGCGAAACTIntegrated HIV-1 DNA (second-round PCR)
AA55MGCTAGAGATTTTCCACACTGACTAA
LTR FL*CACAACAGACGGGCACACACTACTTGAa
LTR LC*CACTCAAGGCAAGCTTTATTGAGGCb
  • a Modified with fluorescein at the 3′ end.

  • b Phosphorylated at the 3′ end and modified with LC red 640 dye at the 5′ end.

  • c Primers and probes were purchased from TIB MOLBIOL (Berlin, Germany). *, probe sequence.