TABLE 1.

Primers used for amplification or mutagenesis of MHV-JHM sequences

Construct and primerOligonucleotide sequence (5′ to 3′)aNucleotidesbFirst MHV amino acid or change(s)
MP1 expression
    B242TTGGATCCAGAATGGTGCTAAGGGATGTGT8882-8897V2890
    B273TAGGATCCAAAATGGGCGCTGTGTTTAGTA8732-8747G2840
    B274TTGGATCCGGGATGGCTAATGTGGCTTGC8564-8578A2784
    B207AATCTAGAAATGATGTAGTAACAGAGGCA10195-102163′ primer
pCen-MP1c
    B347CCTATTTTAACTACACCGGCCTCCCTTAAAGGG8699-8731F2835A
    B349CTATTTTAACTACACCGTTCGCCCTTAAAGGG8700-8731S2836A
    B351CTACACCGTTCTCCGCTAAAGGGGGCGCTGTG8709-8740L2837A
    B353CTACACCGTTCTCCCTTGCAGGGGGCGCTGTGTTTAG8709-8745K2838A
    B275GTTCTCCCTTAACGGGGGCGCTGTG8716-8740K2838N
    B277GTTCTCCCTTAAAAACGGCGCTGTGTTTAG8716-8745G2839N
    B301GTTCTCCCTTAAAGCGGGCGCTGTGTTTAG8716-8745G2839A
    B303GTTCTCCCTTAAAGTGGGCGCTGTGTTTAG8716-8745G2839V
    B279CTCCCTTAAAGGGAACGCTGTGTTTAG8719-8745G2840N
    B305CCCTTAAAGGGGCCGCTGTGTTTAGTAG8721-8748G2840A
    B307CCCTTAAAGGGGTCGCTGTGTTTAGTAG8721-8748G2840V
    B281CCTTAAAGGGGGCAATGTGTTTAGTAGAG8722-8750A2841N
    B283TAAAGGGGGCGCTAACTTTAGTAGAGTT8725-8752V2842N
pPLP2-MP1
    B384cGGGCGCTATGTTTAGTAGAATGTTGCAATGG8731-8761V2842M, V2846M
  • a Underlined nucleotides refer to sequences added for cloning purposes or mutated sequences.

  • b Nucleotides are numbered according to Lee et al. (24) as modified by Bonilla et al. (6).

  • c The sequence of one primer of each complementary primer pair is shown.