TABLE 1.

Primers used for amplification or mutagenesis of SARS coronavirus sequences

PurposePrimerOligonucleotide sequence (5′ to 3′)aNucleo- tidesPolarity or change
Generation of GST-R1 fusion proteinS-5TTGAATTCGAGAGCCTTGTTCTTGGTG268-286Forward
S-6TTCTCGAGATTGAGCTCACGAGTGAG781-795Reverse
Generation of GST-R2 fusion proteinS-9TTGGATCCTCACTCGCTATGTCGACAAC809-829Forward
S-10TTCTCGAGTTCACGACTCAGTATCTC1618-1635Reverse
Generation of GST-R3 fusion proteinS-3TTGAATTCAATGGATACCTCACTTC4651-4667Forward
S-4AACTCGAGCATCACAGCTTCTACAC5486-5502Reverse
Generation of pPLpro-HD expression constructSR-1AAGGATCCGCCATGGAACAAAAACTCATATCAGAAGForward
SR-2CTCATATCAGAAGAGGATCTGCGGGAGGTTAAGACTATAAA4882-5001Forward
SR-4TAGAATTCTTGTGAGTCTTGCAGAAGCC7522-7541Reverse
Generation of pPLpro expression constructSR-49AAGGATCCACTATGGAGGTTAAGACTATAAAAG4884-5003Forward
SR-50GGCTCGAGAACAATTTAGAAAATTTGGGTGA6853-6876Reverse
Generation of pNSP1-3* expression constructSR-47GAGGATCCCCTTGTTCTTGGTGTCAACGAG273-294Forward
SR-48CCGAATTCCACATAGCGATTGTGAAC6873-6891Reverse
SR-60GGAAGCTTACCATGGATTACAAGGATGACForward
SR-61CCGAATTCCGAACCGTCTGCACGCACAC3688-3707Reverse
Generation of pNSP* 3-4 expression constructSR-51CCGGATCCATCATGGATGGTTGCACCTC7393-7412Forward
SR-3TAGAATTCAGAACAGCAGAAGTGATTGATG9959-9981Reverse
Generation of EGFP-HD expression constructSR-110TTCTCGAGCTAAATTGTTCACAATCG6866-6883Forward
SR-111TTGGATCCCCATATGTAGTAGAAAGAAGC7357-7377Reverse
Site-directed mutagenesisb of pPLpro-HDSR-6GGGCTGATAACAATGCTTATTTGTCTAGTG5201-5230C1651A
SR-8CTGCTAACTTTGCTGCACTCATACTCGC5315-5342C1688A
SR-35GGTAACTATCAGTGTGGTGCTTACACTCATATAAC5680-5714H1812A
SR-37GTGTGGTCATTACACTGCTATAACTGCTAAGGAG5691-5724H1815A
SR-39GAGAATTGTATCTTGCTTCGTCTAACGTTACTAC6995-7028N2249A
SR-41TATCTTAATTCGTCTGCCGTTACTACTATGG7003-7033N2251A
Site-directed mutagenesis of pNSP*3-4SR-20CTCACTCAAGGGTGCTAAGATTGTTAGTACTT8469-8500G2740A
  • a Underlined nucleotides were added for cloning purposes or mutated sequences.

  • b The sequence of one primer of each complementary primer pair is shown.