TABLE 1.

Phosphorylated primer sequences used to construct SIV capsid mutants

CA mutantForward sequencea (5′-3′)
Wild typeTGTCAGAAGGTTGCACCCCCTATGACATTAATCAGATGTTAAATTGTGTGGGAG
C46ATGTCAGAAGGTGCCACCCCCTATGACATTAATCAGATGTTAAATTGTGTGGGAG
T47ATGTCAGAAGGTTGCGCCCCCTATGACATTAATCAGATGTTAAATTGTGTGGGAG
P48ATGTCAGAAGGTTGCACCGCCTATGACATTAATCAGATGTTAAATTGTGTGGGAG
Y49ATGTCAGAAGGTTGCACCCCCGCCGACATTAATCAGATGTTAAATTGTGTGGGAG
D50ATGTCAGAAGGTTGCACCCCCTATGCCATTAATCAGATGTTAAATTGTGTGGGAG
I51ATGTCAGAAGGTTGCACCCCCTATGACGCCAATCAGATGTTAAATTGTGTGGGAG
N52ATGTCAGAAGGTTGCACCCCCTATGACATTGCCCAGATGTTAAATTGTGTGGGAG
Q53ATGTCAGAAGGTTGCACCCCCTATGACATTAATGCCATGTTAAATTGTGTGGGAG
M54ATGTCAGAAGGTTGCACCCCCTATGACATTAATCAGGCCTTAAATTGTGTGGGAG
Y49QTGTCAGAAGGTTGCACCCCCCAGGACATTAATCAGATGTTAAATTGTGTGGGAG
I51LTGTCAGAAGGTTGCACCCCCTATGACCTTAATCAGATGTTAAATTGTGTGGGAG
Q53TTGTCAGAAGGTTGCACCCCCTATGACATTAATACGATGTTAAATTGTGTGGGAG
  • a Sequence for nt 1582 to 1635. Bold type indicates the p11C, C-M epitope; underlining indicates mutated codons.