TABLE 3.

Supplemental primers for KSHV microarray

ORFForward primer (5′)Reverse primer (3′)
vMIP-IIGCTGACTGCCTTGCTTTGTTTGGCACCTGTGGTAATGGTCTTTTCTG
vMIP-IIITTCCCTGTCCAGTGCCAGATTGCCCGAGTGCGTTACAAAAATGAC
ORF K4.2GCTGGATTTTTGGACCGTGGAACAACTTGACACAGGGGAAACAC
vMIP-ITTTACCTGACGCCCACAGAAAGGCCTAACCCAGTTTTTGGAAGG
K-bZIPTACGGACAATACTGACGGTGGGGCTGTTGCGAAATGTGTGGTC
ORF K8.1GCAATAGATGAATCGGGGTCGGCGAGGGATTACAGTTGAAACG
ORF K8.2CGTGTGCCATTTTCTGCCACCACTATGTAGGGTTTCTTACGCCG
ORF23CGCATAAAGGTGTTTGACCCAGAGAACTCCCGCTCGTGTGTTTTCG
ORF58GCTGCCCTTCATTGTCTTCTTGAAGTGCCCTGTGGAGTTTTCG
ORF62GTTTATGCTCTCTGGAATGGAAGCTATCACAAGGGAGGGTCAAGCC
LANACCCCAAGGTCCCTCTACACTAAACTCCTGCTGCTGTTGTGAACTTTG
ORF75GGCAGCAAGGAGTTCTTTACGCGGGGTCTCTGAAACCATAAGTTCG