TABLE 1.

Oligonucleotide primers used to amplify SIVcpzTAN1 fragments comprising a complete genomic equivalent

FragmentaForward primerb (name; sequence)Reverse primerb,c (name; sequence)Sized
1CON-1F1; CCAGCNCACAAAGGNATAGGAGGCON-1R1; ACBACYGCNCCTTCHCCTTTC650
CON-1F1; CCAGCNCACAAAGGNATAGGAGGCON-1R2; CCCAATCCCCCCTTTTCTTTTAAAATT
2CON-2F1; AAATGGCTGTGGTATATAAAAATCON-2R1; CCCWTCCAGTCCCCCCTTTTC782
CON-2F2; GCTTAAGAAAGGTTAGGCAGGGCON-2R2; TCCCCCCTTTTCTTTTAAAAA
3CON-3F1; ATYTAYCARTAYATGGATGATAN1-3R1; ATTACTGTGATATTTATCATG944
CON-3F2; GGAAARYTAAATTGGGCAAGTCTAN1-3R2; ATTTATCATGGTCTTCCTGTGC
4TAN1-4F1; CATACCAGAAGAAACAGGAACON-4R1; CTGGKGCTTGTTCCATCTATC1,058
TAN1-4F2; AATTGGCAGGAAGATGGCCTGCON-4R1; CTGGKGCTTGTTCCATCTATC
5CON-5F1; CAGCGACARTAACGCTGACGGTAN1-5R1; GCTGTTCTGGATCCTGCTCCGC576
CON-5F2; ACAATTATTGTCTGGTATAGTGCAACAGCATAN1-5R2; CGCTTGGGTAGGGATCTGTG
6CON-6F1; ATTAAAACCAGGAATGGATGGTAN1-6R1; TATCTGATATGTCCACTGTCCT948
CON-6F2; CCAAGAGTAAARCAATGGCCTAN1-6R2; GCCCCTGCTTCTGTATTGCTGC
7TAN1-7F1; AAGAATATTGACATTCTGCCACTCON-7R1; TACTGCTTTGGTAYAGGATCTTGA533
TAN1-7F2; CAATCAGGACACAGACAGGTAGGGACCON-7R2; CGCTTCTTCCTGCCATAGGA
8CON-8F1; ACAGGAWGTRAAAAAYTGGATGACTAN1-8R1; GGTTTTCTGGTCCAACTGCAGA849
CON-8F2; ATGATGACAGCTTGTCAAGGAGTTAN1-8R2; GTCTTACATATTTCTGTTAATGCC
9TAN1-9F1; GGAACAAGCACCGAACGACAACTAN1-9R1; GCACATCCCCAGAGGCTTAGG2,197
TAN1-9F2; CACTATCGCCATGGTTGTATTAN1-9R2; AGCTGTTGGTCTCTTATGT
10CON-10F1; CCMAGAACCTTAAATGCCTGGGTTAN1-10R1; AGAATCTTTGCCTTATGAGAGGGT494
CON-10F2; RGAAGTMATCAATGAGGAAGCTAN1-10R1; AGAATCTTTGCCTTATGAGAGGGT
11CON-11F1; AACCTGTGACGCCAGGACTCGTAN1-11R1; CCTTGTGCCTGTGGGGTTGTC752
CON-11F2; GAAGATGGGTGCGAGAGCGTCTAN1-11R2; CCTGCTTGCTGGGGTCCTG
12TAN1-12F1; AAGATCTTCATAACACCTCACON-12R1; AAGCTTTATTGAGCATTAAG742
TAN1-12F2; GGACAGGCCTCACAAGACON-12R2; TTGAGCATTAAGAAGCAGGGTCTCC
13TAN1-13F1; CTGGGAGCTCTCTGGTAGTTAN1-13R1; ACGCTGTAGTTCGCTTCC368
TAN1-13F2; CTCTGGTAGTGGCTGGCTTAN1-13R2; TTCCCATGTATCCAGCTTATCTCC
  • a See Fig. 1 for position in SIVcpzTAN1 genome.

  • b CON primers were designed according to HIV-1-SIVcpz consensus sequences (20); TAN1 primers are strain specific. F1, first-round forward primer; F2, second-round forward primer; R1, first-round reverse primer; R2, second-round reverse primer. R = A/G, Y = C/T, M = A/C, K = G/T, S = C/G, W = A/T, H = A/C/T, B = C/G/T, V = A/C/G, D = A/G/T, and N = A/C/T/G.

  • c First-round reverse primers were also used for cDNA synthesis, except for fragment 12, where oligo(dT)18 was used (see text for details).

  • d Size of nested (or seminested) PCR fragments (in base pairs).