TABLE 1.

Oligonucleotides used for cloning and sequencing

Primer namePrimer sequencea (5′-3′)Location
GP33F (SalI)tcgacGATGGCCGTGTTGGTCCTAAGGCTACATAAGGCTGTCTACAATTTTGCCACCTGTCCGSynthetic ORF4a/gp33 fragment
GP33R BamHIgatccGGACAGGTGGCAAAATTGTAGACAGCCTTATGTAGCCTTAGGACCAACACGGCCATCGSynthetic ORF4a/gp33 fragment
FIJ81GTATGGAGGACACCAGGACAG3′ end of spike gene
RIJ84CCATGCATCACTCACATGCC5′ end of ORF5a
EGFP530+CGGTAGGCGTGTACGGTGGGAGGUpstream of multiple cloning site in pEGFP
EGFP 766−GCTGAACTTGTGGCCGTTTACGTCGDownstream of multiple cloning site in pEGFP
  • a Restriction sites are shown in lowercase type. The gp33-41 coding region is in boldface type. The ATG for ORF4a is underlined.