TABLE 1.

Oligonucleotide primers used to amplify bisulfite-treated DNAa

Amplified DNAPrimer pairbProduct size (bp)
5′ LAT promoterULAT1 (5′ GGTTGGTTAAAAAAGGGAGGG 3′), ULAT2 (5′ CTAAAAACTTATATATAAAATCCC 3′)320
3′ LAT promoterLAT1 (5′ AAAATTATATTATTTATTTAYGTGGTGTTG 3′), AT2 (5′ AACAAACRAACRAAACATTCCRAC 3′)271
“a” sequenceAseq1 (5′ GTGTAGAGGTGAGTAGTGTTTGTTTG 3′), Aseq2 (5′ CTCTATTAATTTCACCTATAACAACC 3′)125
ICP4 promoterICP4w1 (5′ GGTTTGTTTTTGGYGGTTTYGYGTYGG 3′), ICP4w2 (5′ CCCRAACCCCRCCCCCTACCC 3′)360
  • a Primers were designed to be complementary to DNA in which all Cs have been converted to U by the bisulfite reaction. In order to prevent bias against DNA that might contain methylated Cs (and therefore be protected from the bisulfite reaction), primer-landing sites containing CpGs were avoided in the design of the primers.

  • b Y can be any C or T nucleotide, and R can be any A or G nucleotide.