Table 1.

Primers used for generation of expression plasmids and for construction of MDV-1 mutants and rescuant viruses

PrimerSequenceaFragment (plasmid generated)
GST-gE15′-ggattcGTAGGAGACGACGTCGCACG-3′GST-gE fusion protein
GST-gE25′-ctcgagTCAGTGGTATAAATCTAAGCG-3GST-gE fusion protein
gI-a5′-CAA tctagaACGGCGTGTGTGATTGCGATG-3′1.5-kbp gI ORF (pcMgI)
gI-b5′-CAA gggcccCCACCTACCTATAATAGTTTC-3′1.5-kbp gI ORF (pcMgI)
gE-a5′-CATAA gcatgcGAGTCAGCGTCATAATGTG-3′1.1-kbp gE ORF (pcMgE)
gE-b5′-CAA gggcccATCAGTGGTATAAATCTAAGC-3′1.1-kbp gE ORF (pcMgE)
gI-kanR-a5′-TCTATAGTTTATACTGGAACATCTGTTACGTTATCAACGGACCAATCTG CGATTTATTCAACAAAGCCACG-3′b Kanamycin resistance gene for gI and gEI deletion
gI-kanR-b5′-CACATTCTTCTCTTTCCAACAATTCGACTTTCTTCTTCAGTTTTTCCATC GCCAGTGTTACAACCAATTAACC-3′b Kanamycin resistance gene for gI deletion
gE-kanR-a5′-ATGTGTGTTTTCCAAATCCTGATAATAGTGACGACGATCAAAGTAGCTGG CGATTTATTCAACAAAGCCACG-3′b Kanamycin resistance gene for gE deletion
gE-kanR-b5′-CTAAGCGTTTCCTAATTTTCGGCATATCATTTTTTAGCCAAGCGGTATAA G CCAGTGTTACAACCAATTAACC-3′b Kanamycin resistance gene for gE and gEI deletion
gI-rev-a5′-TTCAAATCACCTGACGACGA-3′Fragment for gE rescuant
gE-rev-b5′-TAACTCTTCCAACTCCAGGG-3′Fragment for gI rescuant
  • a Restriction enzyme sites are given in lowercase boldface type; sequences in italics indicate additional bases which are not present in the MDV-1 sequence.

  • b For primers gI-kanR-a, gI-kanR-b, gE-kanR-a, and gE-kanR-b, underlined sequences indicate sequences from pACYC177 used to amplify the kan resistance gene. Sequences printed in boldface italic type represent gI and gE sequences which allowed homologous recombination for recE/T-mediated deletion of the genes.