Table 1.

Oligonucleotides used in OE-PCR

MutantPrimer no.Primer designationaSequenceb(5′ to 3′)
E 169 KSIE 173 c 2618a 4980ATCGAAGGTCGTGGGATCCCCCTATG5005
4095b 5020CAGACTGcAgcAAGTATTGcAGACAATCCAGAGAT5055
4096c 5045TTGTCTgCAATACTTgcTgCAGTGTGGGCTATAGCA5010
2619d 5568CTCATGTCCAGAACTCCACGACG5545
E 179 DD 181 2618a 4980ATCGAAGGTCGTGGGATCCCCCTATG5005
7538b 5050GAGATCGcAGcTGcTATTTTTCGAAAGAG5078
3640c 5082TTTTCTCTTTCGAAAAATGgCAgCTgCGATCTCTGGATTGTC5041
2619d 5568CTCATGTCCAGAACTCCACGACG5545
R 184 KR 186 2618a 4980ATCGAAGGTCGTGGGATCCCCCTATG5005
4097b 5065TATTTTTgcAgcGgcAAAATTGACCATCATGGACC5099
4098c 5085CAATTTTgcCgcTgcAAAAATATCATCTTCGATCTCTGG5047
2619d 5568CTCATGTCCAGAACTCCACGACG5545
G198A2618a 4980ATCGAAGGTCGTGGGATCCCCCTATG5005
2620b 5107GGAGCGGctAAGACGAAGAGATACCTTCCG5136
2621c 5126CTCTTCGTCTTagCCGCTCCTGGGTGGAGG5097
2619d 5126CTCTTCGTCTTagCCGCTCCTGGGTGGAGG5097
K199A2618a 5126ATCGAAGGTCGTGGGATCCCCCTATG5005
2624b 5107GGAGCGGGAgcGACGAAGAGATACCTTCCG5136
2625c 5124CTTCGTCgcTCCCGCTCCTGGGTGGAGGTC5095
2619d 5568CTCATGTCCAGAACTCCACGACG5545
M283F2618a 4980ATCGAAGGTCGTGGGATCCCCCTATG5005
2627b 5364CATCtTcGACGAAGCCCATTTCACAGACCC5393
2626c 5374CGTCgAaGATGATCAGGTTGTAATTTGGC5346
2619d 5568CTCATGTCCAGAACTCCACGACG5545
D 334 EE 336 3638a 4792GAAGAAGCCGCGGTCTTGGCATTGGAGCCTG4822
4099b 5517CATGGcTGcAGcAAGAGAAATCCCTGAACG5546
4100c 5533CTCTTgCTgCAgCCATGATTGGTGCAT5507
4318d 6123CACAAAGGTTTTCCTTGCTTCTCCTCTCAAGCGG6090
R 376 KNGK 380 3638a 4792GAAGAAGCCGCGGTCTTGGCATTGGAGCCTG4822
4104b 5641TGCCTGgcAgcAAATGGAgcGAAAGTGATACAACTC5676
4105c 5667CACTTTCgcTCCATTTgcTgcCAGGCAAGCTGCTATATC5629
4318d 6123CACAAAGGTTTTCCTTGCTTCTCCTCTCAAGCGG6090
D 436GEE 439 3638a 4792GAAGAAGCCGCGGTCTTGGCATTGGAGCCTG4822
4106b 5821CTAACAGcTGGTGcAGcGCGGGTGATCCTGGCA5853
4107c 5842CCCGCgCTgCACCAgCTGTTAGTATAACTGG5812
4318d 6123CACAAAGGTTTTCCTTGCTTCTCCTCTCAAGCGG6090
  • a Primers designated a and d are flanking primers; primers designated c and b are mutagenic primers.

  • b All sequences are listed 5′ to 3′, and the substituted nucleotides are in lowercase type. Nucleotide numbering refers to the NGC DEN-2 sequence of Irie et al. (25).

  • c For clustered charged-to-alanine mutants, the underlined residues were mutated to alanine. Amino acid numbering refers to the position of the residue in NS3.