TABLE 4

Primers used for qRT-PCR in this study

Primer namePrimer directionSequence (5′–3′)
uc002yug.2-RT-FForwardCCTTCTGCCATGATTGTGAG
uc002yug.2-RT-RReverseCTGTGAGACGGTGAAGCA
RUNX1a-RT-FForwardCCGAGAACCTCGAAGACATC
RUNX1a-RT-RReverseGCTGTGTCTTCCTCCTGCAT
RUNX1b/1c-RT-FaForwardCGACTCTCAACGGCACCCGA
RUNX1b/1c-RT-RaReverseATGGCCGACATGCCGATGCC
CUL4B-RT-FForwardCCCCTCCCCGAGGCTCTTAATTCT
CUL4B-RT-RReverseCCACGTACACAGGGAAAAGAGCACA
PSMD11-RT-FForwardGGGCTTCCAAGCAAGTCCAGACA
PSMD11RT-RReverseACTGGACCATGCTGCCCTGGAA
β-Actin-RT-FForwardACCGAGCGCGGCTACAG
β-Actin-RT-RReverseCTTAATGTCACGCACGATTTCC
GAPDH-RT-FForwardTGCACCACCAACTGCTTAGC
GAPDH-RT-RReverseGGCATGGACTGTGGTCATGAG
HMBS-RT-FForwardGGCAATGCGGCTGCAA
HMBS-RT-RReverseGGGTACCCACGCGAATCAC
  • a Since there is no specific sequence for primer design to distinguish RUNX1b and RUNX1c with qRT-PCR, this pair of primers was used to detect the total mRNA of RUNX1b and RUNX1c.