Table 1.

PCR primers used in this study

Gene Primer sequence
GAPDHFGGGGAGCCAAAAGGGTCATCATCT
GAPDHRGAGGGGCCATCCACAGTCTTCT
US28FCGTCGGATTCAATGCTCCGGCGATGTTTAC
US28RGAATGGCGATGATCACGGCAAAGATCCACC
CLTF1TAGTCTGCAGGAACGTCGTGGCCTTGGT
CLTF2TCGTCAGGATTATCAGGGTCCATCTTTCTCTT
CLTR1TACATCAATGGGCGTGGATAGCGGTTTGAC
CLTR2AAATGGGCGGTAGGCGTGTACGGTGG
ANTICLTFACTCATGGTCGCTCGGCAGCTCCTTGCTC
ANTICLTRGCACAAACCCCGACACGTACCGTGGCA
DNAPOLF* TGGCTAAAATTCCGTTGCGGCGTGTCAT
DNAPOLR* TGCAAGGGCGGCGACATCTGAAACATA
DNAPOLFGGGCACAGCGGCGGTAGAGATGAT
DNAPOLRTCCCGCGTTGTTTCGTGGCTAATG