Table 1.

Mutants used in study

MutantVirus sense primer (5′-3′)Reverse-sense primer (5′-3′)MutationsRestriction sites
M254-256GAGTGCGCAAGCAAAATTTTGCTTGCGCACTCAA254c
TTATTACATATGGAATTATCAGTTCTTGCCA256
M248-250GGCAGCAACTGCTAATTTAGCAGTTGCTGCCTCA248c 
TTGAGTGAGTGTTGAGTAATCACCA250
M216GGACTATCGATTACACATCGATAGTCCTGCTAGD216 ClaI 645
ACTTGTTGGCGTAATGCAACC
M144-145GGACTATCGATTGGTGCCAATCGATAGTCCTTCI144 ClaI 431
GTCTTTCAACCCTGTGTACAACTGAATGGD145
M62GGTCTATAATATCGATCCGATCGATATTATAGACS62 ClaI 184
GTTTTTATAACTGTGCCAGCTGAAGTTCCAG
M96-97GGCCCGTTGTATCGATTCGTAAGAATCGATACAS96 ClaI 286
CTTACGATTTTTAATGCACGGGCCATAATAGCCI97
M144-145-216a I144 ClaI 431
D145 ClaI 645
D216
M62-96-97b S62 ClaI 184
S96 ClaI 286
I97
  • a Obtained by combination of the M144-145 and M216 mutants by standard cloning techniques.

  • b Obtained by combination of the M62 and M96-M97 mutants by standard cloning techniques.

  • c —, no restriction endonuclease site was introduced.