Table 2.

Deletion mutants obtained from the pcDNA 3M plasmid

MutantReverse-sense primer (5′-3′)Deletion
MΔ253-262CCGGGCCCCTAATTATCAGTTCTTGCCTC253
MΔ237-262CCGGGCCCTTATACATAGTAAGCCCATCC237
MΔ218-262CCGGGCCCCTAGACAATAGTCCTGCTAGG218
MΔ146-262CCGGGCCCCATCAAGACTTAGTCCTTCTGTACAAC146