Table 1.

Primers used for mutagenesis of pFV1 and for recombinant genome sequencing

PrimerSequence (5′→3′)Genome location (nucleotide no.)
FIJ79GCGAATTATAGTGGTGGCACAC944–966 (hemagglutinin esterase ORF)
FS36GCATTAGCACTGAGACCGTTGAAG107–130 (S gene)
RIJ82CTCAGTTAGCTTGTCGTGG255–273 (S gene)
FSQ159LTGCCAGTATACCATTTGTCTGTTACCTTACACTGATTGTAAG456–497 (S gene)
WZL66CTTACAATCAGTGTAAGGTAACAGACAAATGGTATACTGGCA456–497 (S gene)
RS415GTGGCAGCTGTATCAATCTTATAA1244–1267 (S gene)
RS221GTTTATCCGCATAGTACGCAT641–661 (S gene)
IZJ5GCTCCAACAGTTGGTGCC952–969 (N gene)
IZJ6ACGTAGGACCTTGCTAACTTC168–188 (3′ nontranslated region)