Table 1.

Primers used in RT-PCR for transcripts from different EBNA1 promoters

PrimerDNA sequence (5′→3′)Coordinates in B95-8
FGGATCCGGAGGGGACCACTA62249–62268
QGTGCGCTACCGGATGGCG62440–62457
Q′GCGGGATAGCGTGCGCTA62430–62447
Y3TGGCGTGTGACGTGGTGTAA48397–48416
U′CCTAGTGGCCTTGCAGAATT67685–67666
U2′CACACATTCGAGATGGGCAA67729–67710
KCATTTCCAGGTCCTGTACCT107986–107967
Probe (P)ATGCCCTGAGACTACTCTCT67563–67544