Table 1.

HHV-6 primers used in this study

HHV-6 ORFPrimer sequence (3′-5′)Amplimer size (bp)a
cDNADNA
U16-U17AGAACTGCAAATCGTTCCG315b 401
CGTAGAACAGAAGACCGGC
U18-U19-U20TGATGAAGTGCCTATGGTGATT526b 2,064
TAACATCGCAAGGTTGATCAG
U19ACCGAACACTGTCGTATCGT685685
ATCGTCAACTGGTCAAGTGC
U31GATCCGACGCCTACAAACAC831831
CGGTGTTACACAGCATGAACTCTC
U39ACTGGACACAGTAGTCACCG478478
AGACATTGAGGTATTGGATGC
U41GTGAAAACTACGATTCAGGC264264
TTTCGGAACATTGTTGAGC
U42ACGATGGACATGGCTTGTTG525525
ACCTTACAACGGAGACGCC
U53CTGCGTTGCGCAGATACAG652652
CGTTGTAGCTGTCGCAGACTC
U73CAACTTCACTAACGGAGAGG319319
AAGTTGAGAGGCATGCGG
U89-U90c ACAGCTACCGTCCCGATCC682789
GACATCTCTTTGTTGTGTGCC
ACAGCTACCATCCCGATCCd 810e
GACATCTCTTTGTTGTGTGCC
U91CAGAACAGTCAGGTATTTTCCCC374476
GGCGCTGAAGCATGTAAGCA
U94CATCGCATACGTCTCCCAG450450
TCTCTAACGTGTCCGTGCC
U100TGATCGGCCCCGACTCATC7031,045
GTTGCTCCCGAAAGCGCC
  • a Based on the HHV-6A sequence (20).

  • b Putative cDNA (26).

  • c Variant-specific primers. The top sequences are HHV-6A; the bottom sequences are HHV-6B.

  • d —, the cDNA sequence is not available.

  • e Reference 11.