Table 1.

Oligonucleotide primers used for RT-PCR and cycle sequence analysis

PrimerSequence (5′ to 3′)Position (nt)aOrientation
p247CCGTTGTGGTGTCACATTAAC1895–1875Antisense
p493GTAGTAGCATCACTCTGCACTTC1575–1597Sense
p650TGGTGCTGTTGCTGAGCATGA12574–12594Sense
p652ACAACTACTGGTACACCATCAA13323–13302Antisense
p670TCAGTGGTTTACCAGCTTGCA11920–11899Antisense
p685GCCCTTGAGTATAACTTGTGAG11531–11552Sense
p686GAAACTGTGAAAGCTAAGGAGG15500–15521Sense
p687ACACAATGAGATTTACCGCTACC15972–15950Antisense
  • a Numerical position on the genome of TGEV strain Purdue as counted from the first nucleotide of the sequence deposited under GenBank accession no. Z34093 (11).