Table 1.

Oligonucleotide primers used in this study

Primer nameaGenomic location (nucleotides)Nucleotide sequenceb (5′ to 3′)
Strand-specific and competitive template primers
 T7.5UTR.11–20 TAATACGACTCACTATAGGGTTAAAACAGCCTGTGGGTTG
 T7.3UTR.73597341–7359 TAATACGACTCACTATAGGGGCACCGTTATCTAGTTCGG
 2C.4365*47744365–4387* CATACAGTTCAAGTCCAAATGCC*
4774–4798ATCGAGGTTATCTCCATGTACAGCC
 3UTR.73597341–7359GCACCGTTATCTAGTTCGG
REF primers (sense/antisense pairs)
 5UTR.11–20TTAAAACAGCCTGTGGGTTG
 5UTR.603584–603TCAATTGTCACCATAAGCAG
 5UTR.450450–474CCGGCCCCTGAATGCGGCTAATCCT
 1C.21542134–2154TGCGCCTGGTGGTGAGTATGC
 1C.20932093–2120TGTTCTGTGGGTCTGCAATGGCCACAG
 2B.40223994–4022GCCATTGGAATCCCATAATATTGGGACAC
 2A.33073307–3338GGGGCTGTCTACGTAGGCAACTACAGAGTGGT
 2B.44174393–4417CGTGCAAGAGACAGCATACAGGTTC
 2C.43654365–4387CATACAGTTCAAGTCCAAATGCC
 3C.55525524–5552CCATCCTTGTCCACCAACTCTTTAGCGTC
 3C.54795479–5507CCTGGGCCAACCATCCTGATGAATGACCA
 3D.66936669–6693GTTGGTTTCCTTGTGCGAGTATCCG
 3D.6693.82T-C6669–6693GTTGGTTTCCTCGTGCGAGTATCCGc
 3D.62556255–6279CCCGTATGTCGCATTAGGTATCAAG
 Tag.3DT.C7389–poly(A) CGATCTGAGTCATGTCACTGTTTTTTTTTTTTTTC
  • a With the exception of Tag.3DT.C, virus-specific primer names include the viral gene designation and the number of the first nucleotide on the 5′ end of the primer. In primer 2C.4365*4774, the location of a deletion that was engineered into the primer is indicated (*).

  • b Primers 5UTR, 5UTR.603, 5UTR.450, 1C.2154, 2B.4022, and 2B.4417 were based on the published sequence of pNI4. All remaining primer sequences were based on sequence information obtained from CVB1T (unpublished data). The Tag sequence in primer Tag.3DT.C is a nonviral sequence appended to the 5′ end to facilitate amplification of the 3′ end of the virus and is italicized. T7 promoter sequences in T7.5UTR.1 and T7.3UTR.7359 are underlined.

  • c This primer has the same sequence as 3D.6669-93 but with a T-to-C transition at nucleotide 6682 (shown in boldtype).