Table 1.

Oligonucleotide primers used

PrimerSequenceaLocationbRestriction site(s)c
462gcggatccaatattaggcctgaattcgcAATGAAGAAGAAATAGACCGCGGG6753–6773 EcoRI
P113gcgggatccaggcctgaattcgAATATTAATGAAGAAATAGACCG6747–6769 BamHI,StuI
P90gcaggcctCGGGATCGATCGATGGCGAGAAAATCT6770–6792 StuI
P72gcaggcctAATCTAAACATATCAAGAATCAG6788–6810 StuI
P59gcgggatccaggcctgaattcgCAAGAATCAGAATTAGTTTAAG6801–6822 BamHI,StuI
P31gcgggatccaggcctgaattcgcgcgGAAGAGGATTAATCTTGGTT6829–6848 StuI
HPIV2T7gcaggcctggtacctaatacgactcactatagggACCAAGGGGAAAATCAATATG6842–6862 Asp718
HPIV2ribogccatgccgacccACCAAGGGGAAAATCAATATG6842–6862
HPIV2delgctctagatatcTTATGACAACAATGATTA6792–6809 EcoRV
GL-TGAgcgaattccgcggTCACTTGTACAGCTCGTCCATGCCATG5002–5027 EcoRI
GL-ATGgcgaattctctagaaggcctAGCTCACTAGTCGGCGGCCG4284–4303 StuI
GL-1CCATTCACATCGCCATCCAGT4382–4362
Tr′BamgcggatccGAAAAAAGAAGAGGATTAATCT6822–6843 BamHI
Tr′del6gcggatccAGAAGAGGATTAATCT6828–6843 BamHI
Tr′ins6gcggatccgatatcGAAAAAAGAAGAGGATTA6822–6839 BamHI
Tr′del12gcggatccGGATTAATCTTGGTTTTCCCCTTGGTGGGTCGGCATGG 6834–6859 BamHI
Tr′re12gcggatccatttaatctctcGGATTAATCTTGGTTTT6834–6850 BamHI
Tr′ins12gcggatccgatatcatttaaGAAAAAAGAAGAGGATTAA6817–6840 BamHI
Tr′del18gcggatccATCTTGGTTTTCCCCTTGGTgggtcggcatgg6840–6859 BamHI
Tr′re18gcggatccatttaatctctcagtccgaTCTTGGTTTTCCCCTT6840–6856 BamHI
Tr′re25atctctcagtccgtgaccaaTTTTCCCCTTGGTggg6847–6859
  • a 5′ to 3′; nonviral or non-GL bases are shown as lowercase letters.

  • b Location on antigenomic viral RNA or pGreen Lantern-1 plasmid beginning with 5′ viral or GL-specific nucleotide in primer. Number designations for viral sequences are taken from the published SV5 L (31) and HPIV2 L (19) gene sequences.

  • c Relevant restriction sites used in cloning procedures are listed and underlined in the oligonucleotide sequence.