Table 1.

Oligonucleotide primers

PrimerSequence (5′ to 3′)a5′ startb3′ endbUse
21pe1CTTCTTGTACTTTCAAGTTAC3080830828Primer extension
21pe2GTTTTCTCTGGTGACCATGG3085330862Primer extension
21pe3GGAATTTTCTGGGTAGATCG3089730916Primer extension
21-mlu GCGACGCGTAGCTGAGGGGTTAAATTCACA30475304975′-end p21, p21Δ
21-mluAGCGACGCGTGGTAGGAGGAGCC30585305975′-end p21A
21-mluBGCGACGCGTGGTTCTTCAACTTACCGTG30626306445′-end p21B
21-mluCGCGACGCGTGCGTTTTTATTGATGTTAC30663306825′-end p21C
21-mluZGCGACGCGTCGGGGTCACGTCCAGCCTGTG29979300005′-end p21Z
21-kpn GCG GGTACC GGTATATTCTACGCTGACTTAAC30758307363′-end p21, p21A, p21B, p21C
21-kpnAGCG GGTACC GGCTCCTCCTACC30597305853′-end p21Δ
KpnI-MluI-p1TACGCGTGGAATTCCGGTACCGNAc NAModify pCAT3basic
KpnI-MluI-p2CGCGCGGTACCGGAATTCCACGCGTAGTACNANAModify pCAT3basic
4-HindIIICAAAATATCTGACAA(GC)TTGCGTGTTTGCAG41474175IntroduceHindIII site 5′ of ORF 4
4-SpeICAAATTAGTATGTTTTGAC(TAGT)AGCATGAAAAAGG27392771IntroduceSpeI site 3′ of ORF 4
10-EcoRICTTATTTAAACTAAAGA(A)TT(C)TTACTCTATAAG1212812158IntroduceEcoRI site 5′ of ORF 10
10-XbaICGCGTTAAACGTC(TAG)ATTGGGGTAGAG1338513409IntroduceXbaI site 3′ of ORF 10
61-HindIIIGAATACAGCCAA(G)CTTGTTACCATGG104505104482IntroduceHindIII site 5′ of ORF 61
61-SpeIGAAGTCCTAGTT(AC)T(A)GTTGGGAGGGGG103091103067IntroduceSpeI site 3′ of ORF 61
62-EcoRIGGGTACGTCTA(G)AATTCACCCCAG109160109138IntroduceEcoRI site 5′ of ORF 62d
63-HindIIIGGTGCAAAACATGTCC(AAGC)TTGGGGCCGTAGTA110592110563IntroduceHindIII site 5′ of ORF 63
63-SpeITGTATTTATTTATAA(CT)AG(T)ACTACACGCCATGGG111435111404IntroduceSpeI site 3′ of ORF 63
EcoRI-HindIII-p1AATTCCTGGANANALinkEcoRI site to HindIII site in pCIneo
EcoRI-HindIII-p2AGCTTCCAGGNANALinkEcoRI site to HindIII site in pCIneo
  • a MluI sites are indicated by a single underline. KpnI sites are indicated by a double underline. Parentheses enclose nucleotides added to introduce the desired restriction endonuclease.

  • b Nucleotide position of the oligonucleotide on the VZV genome.

  • c NA, not available.

  • d The 3′ cloning site (XbaI) was supplied by the pAlter-1 vector.