Table 2.

Primers for DNA template synthesis and sequencing

NameaSequence (5′→3′)Genomic positionb
FU1 (F)TACAACATGATGGGAAAGAGAGAGAA8993
FU1PMc(F)TACAACATGATGGGVAARAGWGARAA8993
cFD3 (R)AGCATGTCTTCCGTGGTCATCCA10077
cFD3PMd(R)ARCATGTCTTCYGTBGTCATCCA10077
FU2 (F)GCTGATGACACCGCCGGCTGGGACAC9233
cFD2 (R)GTGTCCCAGCCGGCGGTGTCATCAGC9258
FU3 (F)AGCGGAGATGATTGTGTGGT9629
FU3PMe(F)AGYGGAGAYGAYTGYGTNGT9629
cFD4 (R)ACCACACAATCATCTCCGCT9648
cFD4PMf(R)ATNACRCARTCRTCTCCRCT9648
FG1g(F)TCAAGGAACTCCACACATGAGATGTACT8270
G4 (R)CCAGATGTTCTTWGCCCAYTCTGC10261i
VD8h(R)GGGTCTCCTCTAACCTCTAG10728
  • a F, forward primer; R, reverse primer.

  • b Except for primer G4, numbers are genomic positions of YF virus (GenBank accession no. K02749) to which the first bases (5′ end) of primers correspond.

  • c Degenerate primer at the position of FU1.

  • d Degenerate primer at the position of cFD3.

  • e Degenerate primer at the position of FU3.

  • f Degenerate primer at the position of cFD4.

  • g Source, Fulop et al. (14).

  • h Source, Pierre and Deubel (33).

  • i Genomic position of tick-borne encephalitis virus (strain 263) (GenBank accession no. U-27491) to which the first base (5′ end) of the primer corresponds.