Table 3.

Primers used only for sequencing

VirusPrimeraSequence (5′→3′)Genomic positionb
ApoiF5F230 (F)GCTCTATGCTGATGACACCGC204
BanziF8F74 (F)ATGTGGCTTGGGGCTCGCTTT49
F8F322 (F)CTGAGCACCGACAACTGGCAT296
CacipacoreF12F808 (F)TTATGAAGGATGGAAGAAAGC779
JugraF20F590 (F)TTGGAGGTGAACGGAGTGAAC568
F20F622 (F)GTAATGGCAGTGAGCGGAGAT598
KadamF22F770 (F)CTTTTGCTCCCACCACTTCCA741
PotiskumF31F353 (F)TACAAGAACAAGGTGGTCAAA337
F31F623 (F)GCTGTGAGTGGTGATGATTGT604
F31F776 (F)TCGCACCATTTCCACACGCTG757
SaboyaF34F464 (F)TTGGGGAATGGGAGGAGAGCA704
Uganda SF44F581 (F)TGGCTTGAGGTGAATGGCGTA565
SokulukF53F63 (F)AAGAACACAGGGGCTCGGGAC410
F53R160 (R)GACGCCCTCTGCTTCTGCCAT487
F53R498 (R)ATCCTCGCCTTCCCAATCAGC845
Carey IslandF56F152 (F)ACTTTGTGGAGGTGGCGTGGA123
F56F359 (F)GGCATACAAAAACAAAGTGGC330
  • a F, forward primer; R, reverse primer.

  • b The number corresponds to the nucleotide position in the deposited sequence (Table 1) corresponding to the first (5′) base of each primer.