Table 1.

Sequences of oligonucleotides used in RT-PCR and Southern hybridization

OligonucleotideNucleotide sequence (5′→3′)
GAPDH downstreamACCACCATGGAGAAGGCTGG
GAPDH upstreamCTCAGTGTAGCCCAGGATGC
GAPDH probeAAGGACTATGACCACAGTCCATGCC
MVE E gene downstreamCCAACTTCATATTTGATG
MVE E gene upstreamGCTCCTCGTTGCTCCTGC
MVE E gene probeGAAACGTCTGACACAGTAGCTGCATAGCAG
TNF-α downstreamTTGACCTCAGCGCTGAGTTG
TNF-α upstreamCCTGTAGCCCACGTCGTAGC
TNF-α probeCTGGAAGACTCCTCCCAGGTATATGGGCTC
N51/KC downstreamGTGGTTGACACTTAGTGGTCTC
N51/KC upstreamTCGCTTCTCTGTGCAGCGCT
N51/KC probeGCTCTGATGGCACCGTCTGGTGAACGCTGG
iNOS downstreamCGGAATTCGAGCTTCGTGGCTTTGGGCTCCTC
iNOS upstreamCGGGATCCCTTCCGAAGTTTCTGGCAGCAGCG
iNOS probeACGTTCAGGACATCCTGCAAAAGCAGCTGG