Table 2.

Oligonucleotides used in this study

Gene and nameSequence (5′ to 3′)LocationOrientationa
VZV ORF21
 V1CCGAATCTATTGCAACCGTG33475b Sense
 V2TTGTCCTATTATCAGCGTCGG33791Antisense
 V3GCCCCAACCTCATATATGAG33546Sense
 V4GAAATTACGTCTCTGACCGTTG33763Antisense
 VPACAAGGCAGCAGTTTCATTCG33588Sense
β-Actin
 A1GATGCATTGTTACAGGAAGT3260c Sense
 A2TCATACATCTCAAGTTGGGGG3500Antisense
 APCAAGTCCACACAGGGGAGGTG3339Sense
  • a Sense, same (5′-to-3′) direction as the ORF; antisense, opposite (5′ to 3′) direction to the ORF.

  • b Location of the 5′ nucleotide with respect to the VZV genome (4).

  • c Location of the 5′ nucleotide with respect to the β-actin cDNA sequence (15).