Table 1.

Synthetic oligonucleotides in this study

OligonucleotideaSequencebBinding regionc
BCVDI420(−)5′GTTGTGTGCAGTCTAGCCTAATAC3′419–442
TGEV#8(+)5′CATGGCACCATCCTTGGCAACCCAGA3′1099–1128
TGEV#7(−)5′TCTGGGTTGCCAAGGATGGTGCCATG3′1099–1128
BCV#3(−)5′TGGGAATCTTGACGAGCCCCAGAAGG3′1542–1567
5′S1(−)5′AAGGCACTCTTGTACAGAATGGATG3′1931–1955
5′S2(−)5′GGATGTCTTGCTCGATTAATAGATAGAG3′1951–1978
3′S1(−)5′GCTATAATAGTACAAGCAGGTTATAGC3′1963–1989
3′S2(−)5′GAGAAGGTTAATCGAGACTATAGATTAATTAG3′1976–2007
BCV3′UTR(+)5′CCAACACTATACATTACCAC3′2021–2040
BCV3′end(+)5′TCGGCAATTACTTCCGCAAG3′2054–2073
Reverse(+)5′CACAGGAAACAGCTATGACC3′
  • a Oligonucleotides bind to either plus-strand RNA, as indicated by (+), or to minus-strand RNA, as indicated by (−).

  • b Underlined bases indicate differences from the genomic sequence.

  • c Numbers correspond to the pDrep1 plus-strand sequence, except for oligonucleotides TGEV#8(+) and TGEV#7(−), for which numbers refer to the TGEV N gene plus-strand sequence (11). Reverse(+) binds to pGEM3Zf(−) DNA just downstream of the multiple cloning region.