Table 1.

Oligonucleotides used for amplification of HHV-6B genome segments

NameTypePrimer coordinatesaSequenceAnnealing temp (°C)Size of amplimer (kb)
TLcPCRc P1, 3–285′TCGCGTTTCAAAAATTACTTTAAAC601.5
P2, 1456–14805′TGCGTACACGGCCACCCGCGTCTCC
DRL/UPCRd P1, 4941–49655′GTAAGAGAGAGGCCCCGGTCCACAT685.2
P2, 10140–101625′ATGAGTGGAGTTGACGACGCCCTG
U-1cPCRP1, 22633–226535′GAGATGGACACTGTCATTGAG556.8
P2, 29458–294755′GTGGTCGGCGGATTAAAT
U-2cPCRP1, 34599–346185′CCGCTTCTCCAATTTCTGTA551.5
P2, 36092–361115′TGCCTCAATTGCGTCTAAAA
U-3PCRP1, 35928–359235′CACGGCTAGCGTAGAGGTCACCATAG6011.5
P2, 47479–475045′TGTAAATCAAGAGGATGTCCAGATTG
U-4PCRP1, 52486–525105′TTTGTATCTGTAACATTCGACACAC606.2
P2, 58698–587225′CTCGCTCTCAAAACAACATGTAACT
U-5PCRP1, 58624–586415′AAGACAGGTTACAGAAGC505.5
P2, 64143–641605′AGGAAGATGAGGTTCAAC
U-6cPCRP1, 125916–1259345′CATGTTGAATCATAGGTCGb 501.6
P2, 127510–1275305′ATGATAATTTACGCCGCTACGb
U-7PCRP1, 127413–1274335′CACCGTCGATGATTGAACACAb 482.3
P2, 129765–1297855′ACAGGAAACCTAACTGCAATTb
U-8PCRP1, 129765–1297855′AATTGCAGTTAGGTTTCCTGTb 482.0
P2, 131811–1318295′GATCCCATATCTTCTCAAGb
U-9cPCRP1, 131811–1318295′CTTGAGAAGATATGGCATCb 501.5
P2, 133342–1333595′TCAGCAATTTCAACTCCAb
  • a Coordinates refer to the HHV-6B genome sequence. TL primer sequences are also located at coordinates 153325 to 153349 and 154577 to 154801.

  • b Based on HHV-6A genome sequence (19). Differences between HHV-6A and HHV-6B are in boldface.

  • c cPCR denotes that the PCR product was cloned into a pCR-Blunt vector by using a Zero Blunt PCR cloning kit (Invitrogen, San Diego, Calif.).

  • d PCR conditions differ from those described in Materials and Methods as follows: 94°C for 15 s and 68°C for 9 min (16 cycles); 94°C for 15 s and 68°C for 9 min, with an increase of 20 s every cycle (12 cycles); and 72°C for 10 min (2 cycles).