Table 1.

Alignment of independent ZAM integration sites from the genome of strain wIR6Rev

SequenceInverted repeatIntegration site
+1+28
1  AGGTAACT CGCGCGTGCTGTAAGCTAACGCCGACTT
2  AGGTAACT CGCGCGGTAGTTGGTTCGGCCACAACAG
3  AGGTAACT CGCGCTCATTATTGGCCATGTTAGTTAG
4  AGGTAACT CCCGCGGCGCACATCAATTGATTTACCG
5  AGGTAACT CCTGCGACAGCCACATCAAAAGGATCCA
6  AGGTAACT CGTGCCCTGACCAATCCAAAGAGCTCAC
7  AGGTAACT CGCGCAGTTGAGAGCATAGCTCCTGTGC
8  AGGTAACT CACGCGGCCTTCAGCCGCCTCATCAGCT
9  AGGTAACT CACGCCCTCCGGCTGCCGTAGCACATTG
10 AGGTAACT CGCGCTTAACAAAGGTCCTGGAAACCGA
11 AGGTAACT CGCCCCAACCCGAGACCCAGAATCCCCA
12 AGGTAACT CGTGCGTTGGTGTGTGTGCCGCCCGCTC
13 AGGTAACT CCCGCAAGGAGGACACACGGCTAAGTCC
14 AGGTAACT CGCTCGTGTACAAATTACGAAGAACTAC
15 AGGTAACT CGCGGCAACAGCGCACAACAAGCTGAGA
16 AGGTAACT CGCGCACCTCCGCCGGAGAGAATAGCCA