Table 1.

DNA oligonucleotides used in this study

OligonucleotideSequenceComment
U3NdeI5′ CATATGGAAGGGCTAATTTGGTCCC 3′pNL43 primer for preparing LTR substrate
U5NdeI5′ CATATGCTAGAGATTTTCCACACTG 3′pNL43 primer for preparing LTR substrate
CH15′ CAGGGAAGTAGCCTTGTGTGTGGTAG 3′Primer for sequencing coupled products
HU3A5′ CTGGTAACTAGAGATCCCTCA 3′Primer for sequencing coupled products
T7 20-mer5′ TAATACGACTCACTATAGGG 3′Sequencing primer (T7 Universal)
FB 2535′ CGCCATATGAGTGAGTCGAGCTCGAAGTCC 3′Primer for amplifying HMG I(Y)
FB 2545′ CTGGATCCTCACAGTTTTTTGGGTCTGCCCCTTGG 3′Primer for amplifying HMG I(Y)
4658-3335′ AAGATCTGGACGACGACGACAAGATACAGAAAGGCAATTTTAGGAAC 3′Primer
4658-3565′ GTACGTGTCGACCCTAATTAATTAGCCTGTCTCTCAGT 3′Antisense primer