Table 1.

Oligonucleotides used in this study

OligonucleotideSequenceSensePurpose
BL275′GGTACCTGCAGCGGCCGCTAAAGTTTAGATTACACATTAGAGTCATC3′Construction of pBL83
BL285′AATTGCGGCCGCTGCAGGTACCAGAGAATGAATCCTATGT3′+Construction of pBL83
PM1125′CCATGATCAACTTCATTC3′Construction of pBL83; RT-PCR analysis of viral mutants; complementary to nt 18 to 35 from the 3′ end of the genome
PM1195′TAGTACTCTACCTGGTTT3′+Construction of pBL83
BL645′ATGAAGGTACCAATGTAAGCGTTGC3′+Construction of pBL108
BL655′ATTCAGGTACCTTACACATTAGAGT3′Construction of pBL108
PM1435′TATAAGAGTGATTGGCGTCCGTACGTAC3′+RT-PCR analysis of viral mutants; identical to the 5′ end of the leader sequence
BL195′TTTTTTTTTTGTGATTCTTC3′RT-PCR analysis of viral mutants; complementary to nt 1 to 10 from the 3′ end of the genome plus 10 nt of the poly(A) tail