Table 2.

Oligonucleotide primers used for amplification (RT-PCR) and thermocycling conditions

Primer nameaSequence (5′→3′)Genome positionbLength (nt)Thermocycling conditon
MeltingAnnealingExtensionc
D2/11VCTACGTGGACCGACAAAGACAG11–3267094°C for 30 s55°C for 30 s70°C for 2 min
D2/662GGTACAAGTCCCATAGGTTA662–681
D2/618VACCAGAAGACATAGATTGTTGGTGC618–6421,98494°C for 35 s61°C for 35 s70°C for 2 min
D2/2578TTACTGAGCGGATTCCACAGATGCC2578–2602
D2/2406VAGTCATGGTGCAGGCCGATAGTG2406–24283,34594°C for 40 s62°C for 40 s70°C for 3 min
D2/5728AATGTCAGTTGTAACCACGAAATC5728–5751
D2/2406V-IId AGTTATGGTGCAAGCCGATAGTG2406–24283,34594°C for 40 s62°C for 40 s70°C for 3 min
D2/5728d AATGTCAGTTGTAACCACGAAATC5728–5751
D2/2409Ve GGGAGCTATGGTGCAGGCTGATA2409–24313,34294°C for 40 s62°C for 40 s70°C for 3 min
D2/5728-IIe AATGTCAGTTGTAACCACGAAGTC5728–5751
D2/5442VTGAGGCAGCTGGGATTTTTATGAC5442–54652,08094°C for 35 s60°C for 35 s70°C for 2 min
D2/7500CTCCGGCCAAGTAACTCCCTCTA7500–7522
D2/7243VGGCATCATGAAAAACCCAACTGT7243–72653,08494°C for 40 s62°C for 40 s70°C for 3 min
D2/10304TACTATGGCTTAACTCGACCTGAC10304–10327
D2/9948VAACCTGGTCCATACATGCTAAACA9948–997174794°C for 30 s60°C for 30 s70°C for 2 min
D2/10676CATTTTCTGGCGTTCTGTGC10676–10695
  • a Primer names with an V indicate a viral-sense orientation; names without indicate a complementary sense orientation.

  • b Genome positions are given according to the published sequence of strain 16881 (17).

  • c Thermocycling occurred 30 times, with extension times increased for the last 20 cycles for 10 s/cycle.

  • d Primer modification for Ven2, 0131, IQT1797, and IQT2913.

  • e Primer modification for Mara4 and 102692.