Table 3.

Nucleotide sequence at discriminative sites of the HA1 protein

H7 LBM isolateNucleotide sequence at discriminative site:
84a126218b258270310326342389468530543586732765876894900942958
CK/NJ/15086-3/94TCAGAGATGCGGGTGAACCA
CK/NY/13142-5/94TCAGAGATGCGGGTGAACCA
CK/NY/4447-7/94TCAGAGATGCGGGTGAACCA
TK/NY/4450-5/94TCAGAGATGCTGGTGAACCA
GF/NY/13820-3/95TCAGAGATGCGGGTGAACCA
CK/NY/13833-7/95CTAGTGATAAGGGCAAGCTC
CK/NY/19542-5/95TCAGAGATGCGGGTGAACCA
CK/NY/3112-1/95CTCGTGATAAGGGCATGCTC
CK/RI/4328/95CTAGTGATAAGGGCATGCTC
CK/NY/3202-7/96TACATAGCAAAGACATGCTC
GF/PA/7777-1/96CTCATAGCAAAAACATGTTC
CK/NY/8030-2/96CTCGTGATAATGGCATGCTC
CK/PA/11767-1/97CTCATAGCAAAAACATGTTC
CK/NY/6777-3/97CTCATAGCAAAAACATGTTC
TK/PA/7975/97CTCATAGCAAAAACATGTTC
CK/PA/13552-1/98CTCATAGCAAAAACATGTTC
Quail/NY/13989-51/98CTCGTGATAATGGCATGCTC
  • a Nucleotide position based on the HA1 nucleotide sequence of consensus H7 sequence.

  • b Nucleotide sequence positions in boldface represent nonsynonymous nucleotide changes.