Table 1.

Oligonucleotides used for PCR Amplification and site-directed mutagenesis

NameNucleotide sequence (5′-3′)aPosition
T7TAATACGACTCACTATAGGG
AD-2CAGCTGCCATGGACAACAACTTGCATGAGA3827–3856
AD-3AATTAGGATCCTAGCTAGCGACAACACTCTT5759–5740
XHY-7GTGGCAGGATCCGTTATTATTTGC6097–6120
LKP-14GGTTTGCGGATCCATGGGTAAGACTGTCAC2532–2561
LDX-4TCTGTTTGCAAGTTACATCG4060–4041
SLKP-2GGTGTTTATATTTAACAGCCAG7832–7853
LN-6ACCAGAGGATCCTATTGTAATCTACT8885–8854
LN-1GTTATACCATGGATAAAGTGTGTAGC6865–6885
LN-5TTTCAACCATGGGTGTTTTTAAAGCT8272–8292
LN-10GTTAGTAGATTAGAGTCTGGTTTTAAG8852–8877
LN-11CAGTTTCTTAAAACCAGACTCTAATCT8857–8883
LN-54AAGGCAGGTGGATCCGTATTGTTAGCGGC7315–7338
LDX-44ATTTGAGGCCTTACCTTTCAGCG8685–8702
XIANG-35TTAACAGGATCCTATTGTAATCTAAC9879–9855
LKP-28GTGGAACTATCCCGGGTTAACCATTGGGTTG7975–7945
LKP-29GCCGCTCCCGGGTTAACCTGCCTTTTTC7338–7311
LKP-28dGGAGAGAAAAAGGCAATTGTTAGCGGCAC7308–7340
LKP-28dG1AGAGAAAAAGGCAGGTATTGTTAGCGG7308–7337
LKP-28dGACTTTATAACAAAGTCTAAACAAGTTATTG7248–7282
LKP-28dGVCTACTGTTAAGTCACGTTTCTTTATAAC7223–7256
LKP-28A-NGTAGAGAAAAAGAACGGTGGTATTGTTA7306–7333
LKP-28G1-AGAGAAAAAGGCAGCCGGTATTGTTAGCG7309–7336
LKP-28G1-NGAGAAAAAGGCAAACGGTATTGTTAGCG7309–7336
LKP-28G2-NGAAAAAGGCAGGTAACATTGTTAGCGGC7311–7338
LKP-28N-QGTATGATGTACAGTCCACACTGCATGT7455–7481
LKP-30CTTGGCTCAGGCCTAACAAAAGAACGCG4024–3997
LKP-31GGTCATCCATCTAGATATAGTAAGTCTC5350–5377
LKP-32GAGAAAGGATCCATGGGTATTGTTAGCG7309–7336
LKP-33CAGTTTCCCCGGGCCTTATTGTAATCTAC8883–8855
  • a Underlining denotes the initiation codon (ATG), termination codon (TAA), and a T insertion, respectively.