TABLE 1

List of all primers used to produce the various plasmid constructs detailed together with target sequences for the FADD and ATG3 siRNAsa

Primer or targetSequence
GB1vFLIP-FwdTTgaattcGATGGCCACTTACG
GB1vFLIP-RevAActcgagCGCCTATGGTG
GST Fwd agatctGCCACCATGTCCCCTATACTAGGTTATTGG
GST Rev gtcgacctactactaggatccACGCGGAACCAGACCACCACC
GST-IKKγ-Fwd gatccTTGCAGGTGGCCTATCACCAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGTtag
GST-IKKγ-Rev tcgactaACTGCCCACCACGCTGCTCTTGATGTGGTTGTCGTATTCTTGGAAGAGCTGGTGATAGGCCACCTGCAAg
GST-IKKγDM-Fwd gatccTTGCAGGTGGCCTATCACCAGCTCcgCCAAGAATACcgCAACCACATCAAGAGCAGCGTGGTGGGCAGTtag
GST-IKKγDM-Rev tcgactaACTGCCCACCACGCTGCTCTTGATGTGGTTGcgGTATTCTTGGcgGAGCTGGTGATAGGCCACCTGCAAg
FADD target 1CATGGAACTCAGACGCATCTA
FADD target 2TGAACTCAAGCTGCGTTTATT
ATG3 target 1CCAGAACTTATGACCTTTACA
ATG3 target 2ATGTGACCATTGACCATATTT
  • a The restriction sites, stop codons, and positions mutated in the IKKγ double mutant GST constructs (GST-IKKγDM-Fwd and GST-IKKγDM-Rev) are shown in lowercase and are underlined.