TABLE 2

Genotype-specific and control primersa

HCV genotypePrimer nameOuter/innerPolaritySequence (5′–3′)PositionsbAmplicon size (ntc)
HCV-1aFext-1aOuterSenseGGCATGGGATATGATGATG1295–13131,269
Rext-1aOuterAntisenseATGAGTARCATCATCCA2547–2563
Fspec-1aInnerSenseTCCATGGTGGGGAACTGGGCGAA1428–1450578
Rev-1aInnerAntisenseATCCAGGTGCAACCGAACCAATTGCC1980–2005
HCV-1bFext-1b2OuterSenseATGGCTTGGGAYATGAT1293–13091,123
Rext-1b2OuterAntisenseGRTGGATYAARCCRGTGGA2397–2415
For-1bInnerSenseGCGGGCCTTGCCTACTATTCCATGG1410–1434623
Rev-1bInnerAntisenseCACGTCTTGGTGAACCCAGTGC2011–2032
HCV-4aFext-4aOuterSenseTGATGAACTGGAGTCCAAC1309–13271,138
Rext-4aOuterAntisenseAGGTACTGGACGTCCACG2429–2446
For-4aInnerSenseGCYAATTGGGCCAAAGTCATC1437–1457679
Rev-4aInnerAntisenseGTCTCCGGATGCTTCCTGAA2097–2116
Sanger (1a)NS1aNAdSenseATAACGGGTCACCGCATGGCATGGCATGGGATAT1278–1312
NS1bNAAntisenseCACCACCACGGGGCTGGGAGTGAAGCAAT1861–1889612
ER2StuNAAntisenseCCAGCGGAGGCCTGGTGTTGTTAAGG1955–1980706
E2814–842NAAntisenseGGGCTGAGCTCGGACCTGTCCCTGTCTTC2304–23321,055
  • a Barcoding, read signals, and adaptor sequences were engineered at the 5′ end of the sense primers as per the manufacturer's instructions.

  • b Numbering of the nucleotide positions is according to that of the H77 HCV-1a isolate (GenBank accession number NC_004102.1).

  • c nt, nucleotides.

  • d NA, not applicable.