TABLE 3

Oligonucleotide primersa

AnalysisPrimerSequence (5′–3′)bCoordinates or accession no.
Synthesis of inserts
    CyHV-3 ORF25ORF25outFCCTCCGACTCTGAAGACGAT45389–45408
ORF25outRGGTACGTGATGCTGTAGAAG47569–47588
    CyHV-3 ORF32ORF32outFCCAGGTCCAGGCAGTCTC54216–54233
ORF32outRATGCGCGTCTACAAGATCG55619–55601
    CyHV-3 ORF59ORF59outFGACGCCTGTCTCTGGTAGA101541–101559
ORF59outRGCGTCTCCAAAAAGAGCGG102941–102923
    CyHV-3 ORF64ORF64outFGTCGAGATATCCGAGGCAGA119716–119735
ORF64outRTTCATAGCCACAACCGGAGT122203–122184
    CyHV-3 ORF65ORF65outFTGGAGAACATCAAGCAGCAC121920–121939
ORF65outRGAAGTCTGAAACTGTCTGAATG124106–124127
    CyHV-3 ORF81ORF81outFGGTTTAGTCCAAATCCGACCT150519–150539
ORF81outRGCAGCTTCTGCTTCAGAGTG152023–152004
    CyHV-3 ORF83ORF83outFACACGCTGATGGTCACGAG152549–152567
ORF83outRACACCAACCAGTTCGTGCAG153638–153619
    CyHV-3 ORF99ORF99intFGCTTAGCCTGTTCGGCAC184445–184462
ORF99intRAAGATCTGGGACACGGACTG185515–185496
    CyHV-3 ORF106ORF106outFGCTGACACCTGTCACAACCA195629–195648
ORF106outRTCGTGAGGACAAACCGTCTC196189–196170
    CyHV-3 ORF108ORF108outFGATGATGAAGGGTGTTCATG201067–201086
ORF108outRCATCTACAAGTCGGACAACC201937–201956
    CyHV-3 ORF115ORF115outFCACGTAAACGAAGCCCCATA207951–207970
ORF115outRATTCGTGGCGGCTGTTATAC210734–210715
    CyHV-3 ORF131ORF131outFGCCCTGGTCCTCGTACTTTT224971–224990
ORF131outRCTGATCAGATTCTCAGGAGCAG227271–227250
    CyHV-3 ORF132ORF132outFGCTCCTGAGAATCTGATCAG227252–227271
ORF132outRGTTAATGGTCACAGAAGCGC228155–228174
    CyHV-3 ORF136ORF136outFGTGTCAAGTACGTGGAGCGT231157–231176
ORF136outRGGCCTCTGAATGTGTTATTGC231991–232011
    CyHV-3 ORF148ORF148outFCATGGTTCGAGGTTGTGAAG253808–253827
ORF148outRCAGCATTCGTCTCTTAGTGC255933–255952
    CyHV-3 ORF149ORF149outFACCCTATCATGATTGACGGC255770–255789
ORF149outRCTTTCGTTCTACTGTTCCTC258172–258191
Synthesis of galK recombination cassettes
    ORF 25 Del galKORF25 galK FGTCATTTTTCCTCGTGGTGTGCAGCTTTTTCTAACGTGTGGTAGGACGCTAACCATTACCAAGTAAACCATTACGCCTGTTGACAATTAATCATCGGCA45495–45569
    ORF25 galK RTGACCAGGGTAGAATGATAGACCCGCCGCTAAGAAAAATGACTCTCCGTCCGCTACCGTCGCCCGCTATAGTGTTTCAGCACTGTCCTGCTCCTT47376–47450
    ORF 32 Del galKORF32 galK FATAATACGCACCCTGGTCACTTTCTTTAACGTGTCCGTGTCGGGCTCCCTACACGTTTCCTCCGAGTCGCCGATCCCTGTTGACAATTAATCATCGGCA54417–54491
    ORF32 galK RCTGTATCCCATCAGGGGCTGATCTGCTGACGGCCTCGACGTGGTGGTGATGGTGGTGGTGGTGGTGATGATGATGTCAGCACTGTCCTGCTCCTT54491–54417
    ORF 59 Del galKORF59 galK FCCCGCACGACGTCGGACGCTCCCTACCGAGTGAGCCGTCTCTCTGACCCGGGTCGTGCGGGCGCCACCAGCCCTTCCTGTTGACAATTAATCATCGGCA101961–102035
    ORF59 galK RAGCAGTGGTAGTCCTCTCACCCCCCCCCCCCCCCCCTTGACCTTCACCCTTCACCCCTAACCCCAACAACCAACCTCAGCACTGTCCTGCTCCTT102521–102447
    ORF 64 Del galKORF64 galK FTGGTCCTCCCATGCTTTTTATTCAATCCTGCTCCTCTTGAAAAGCTTAAGCCTGTTGACAATTAATCATCGGCA119814–119863
    ORF64 galK RGTACACTATATTGCGTTTATTTGTTTTTCATAAAAAGCACATACATAATATCAGCACTGTCCTGCTCCTT122082–122033
    ORF 65 Del galKORF65 galK FCAATATAGTGTACACCGTGGTCTTTATTAATTTGATAACATAATAATGTACCTGTTGACAATTAATCATCGGCA122070–122119
    ORF65 galK RCAAGACGCCTCACACGACGGAAACCCGCAACACCACCCCACAAACAAACGTCAGCACTGTCCTGCTCCTT123911–123960
    ORF 81 Del galKORF81 galK FGCACTTGAGAGCAGCGGAGGAGAAGACCGGTGCATCCATCTCGACGCTCGTCAGGTTGTGACTGTCCTCGTCCTCCCTGTTGACAATTAATCATCGGCA150722–150796
    ORF81 galK RCGGCTGCTGTGTTTTGTGGTGCTGGCCTCGACTGTGGGGTGGTGGTGGCGGCGACTGCGAGAGGCTTCGGAATCAGCACTGTCCTGCTCCTT150796–150722
    ORF 83 Del galKORF83 galK FCACAATAAAAAGCTCCCCTCGGGGATCACCAAGACAACCTTTCAGTAGCCCCTGTTGACAATTAATCATCGGCA153481–153530
    ORF83 galK RTCTTCGCCCTCGCCCTCGTCCCTCAACCTGTTGTACCTATACGCGCTCATTCAGCACTGTCCTGCTCCTT152758–152807
    ORF 99 Del galKORF99 galK FTGCAGGCCACCGCCGCCAACGCCGAGATGTCCAACAACCTCCAGACGCAGCCTGTTGACAATTAATCATCGGCA184714–184763
    ORF99 galK RAGGGCTTGCTCTTGAGGAAGGGCTGGTTGACGGGGCAGCCCTGCAGGTAATCAGCACTGTCCTGCTCCTT185214–185165
    ORF 106 Del galKORF106 galK FACTACTCGCCCACCGCCTTATACAACTTCACCGCGTATCCGCCGTACATCCCTGTTGACAATTAATCATCGGCA195727–195776
    ORF106 galK RGGGTTTGGTAGAGGGCGCTGCGGGGGATGAGCCCGACGATACCGCTGCGGTCAGCACTGTCCTGCTCCTT196063–196014
    ORF 108 Del galKORF108 galK FCACTTAGTCTACCACTCACTTTACCTTACAACCACCCAGACACCAACACACCACACCACCCACACTACGAGCGAGCCTGTTGACAATTAATCATCGGCA201156–201230
    ORF108 galK RACCAAGCAACACGTTCATGTGATTTTTTTTTATTGTTGATGTTGTTTGATGTATTACAGTTACAATAAACGTAATTCAGCACTGTCCTGCTCCTT201819–201893
    ORF 115 Del galKORF115 galK FATCGTGTCCTCCGTCTCGGTCATCTCTGTGGTTTTTTCCAGCTTTGCGCCCCTGTTGACAATTAATCATCGGCA208152–208226
    ORF115 galK RGCTCAAAATAAAAAAAACATGTCTGGACCTTTACATCTTGTTTCAATAATTCAGCACTGTCCTGCTCCTT210641–210567
    ORF 131 Del galKORF131 galK FGTGAGGGAGTGATATGGAGTGAACGTAAATGGAGGGGCGCTGCGGAGGTTCCTGTTGACAATTAATCATCGGCA225410–225484
    ORf131 galK RTCGAGACGCCCGAACTGGTCGAGGCCTACGTGAACGACGTCAAGGTCCGCTCAGCACTGTCCTGCTCCTT226426–226352
    ORF 132 Del galKORF132 galK FTCAAGTCTTTATTATTACTTTATTTAATGGGGTTCGGTTGGAGAAGAGCAGTCAAGTGAGCAGAAGAGAAGATCGCCTGTTGACAATTAATCATCGGCA227369–227443
    ORF132 galK RAACTGAGGCCTCTCCGGCTATCCGCACCGAGTGATATACCGCCCGCCACTACCCCAGAACCCCCACACAGCCGCATCAGCACTGTCCTGCTCCTT227957–228031
    ORF 136 Del galKORF136 galK FAAGCTTGCCTTTGAAACATGGAAAAGAGCTCTCGTGTGTTTCTTTAGAATAAGACGACGTCGAGCGACGACCATCCCTGTTGACAATTAATCATCGGCA231264–231337
    ORF136 galK RTGTTGGTTTGCTTTGGCTTGATAGCACACAAAAATCACATTTGTAAGAGTTTTATTGTTTGACAATGATACATCATCAGCACTGTCCTGCTCCTT231801–231875
    ORF 148 Del galKORF148 galK FGAGGGTAGAGAGGGCTGGAGAGTAGGAGAGGAGAGAGGGGAAAGTTTTGAAGTTCTTGCACATGTTGAGGGGAAGCCTGTTGACAATTAATCATCGGCA253881–253955
    ORF148 galK RAAAACCAAAATTTTTCTGTTATCGTATCGTGATGAGCGCGACCGAGGCGACGGTCCAGTAACTCCGCCGTCAATCTCAGCACTGTCCTGCTCCTT255780–255854
    ORF 149 Del galKORF149 galK FTTTGCTTTTTTTATTATGTGATGCTGTAGTGTACACACGTATTAGAAACAATAGTAGAGCAAGCAAGCAAAAGCCCTGTTGACAATTAATCATCGGCA255861–255935
    ORF149 galK RTTTTCTTTTGACGCGCAATGACCGACGGCTCAAGTGACGGCTACCTAGACGATACGTCACAGACGGCTGAGGACCTCAGCACTGTCCTGCTCCTT257997–258071
Nonsense mutagenesis of essential genesc
    ORF32ORF32.T237G-senseGACAACGGCTGGGGCTAGACCTTTCTGATCCAATC54711–54745
    ORF32.A237C-antisenseGATTGGATCAGAAAGGTCTAGCCCCAGCCGTTGTC54745–54711
    ORF59ORF59.C144G-senseCATGCAGCGCTAGCAACTGTGCGAG102315–102291
    ORF59.G144C-antisenseCTCGCACAGTTGCTAGCGCTGCATG102291–102315
    ORF81ORF81.C207G-senseTTGCGCACGCCATGTAGTCCAACGATCCC150987–151015
    ORF81.G207C-antisenseGGGATCGTTGGACTACATGGCGTGCGCAA151015–150987
    ORF83ORF83.G225A-senseGTTCATGTACTGAGTCACCCTACGC153268–153244
    ORF83.C225T-antisenseGCGTAGGGTGACTCAGTACATGAAC153244–153268
    ORF99ORF99.C3039G-senseCAACGACAGGTTCTCGTAGGTGGCGAGCC184946–184974
    ORF99.G3039C-antisenseGGCTCGCCACCTACGAGAACCTGTCGTTG184974–184946
    ORF106ORF106.CA108AT-senseCTTCGTCGTCTAATAGGCCCAGCAC195872–195896
    ORF106GT108TA-antisenseGTGCTGGGCCTATTAGACGACGAAG195896–195872
    ORF115ORF115.C744A-senseGGACCTGGTCCTGTAATCCCAGACGAACGTG208955–208985
    ORF115.G744T-antisenseCACGTTCGTCTGGGATTACAGGACCAGGTCC208985–208955
    ORF131ORF131.C735G-senseTCCAGGGCCGTGTAGGAGGCCGC226054–226032
SDM131.G735C-antisenseGCGGCCTCCTACACGGCCCTGGA226032–226054
Synthesis of probes for Southern analysis (probe name)
    GalKGalK.Int2-FAGGTGAGGAACTAAACCCAG
    GalK.Int2-RCGTATTGCAGCAGCTTTATC
    ORF32ORF32.SB-FCAGATGTGGCTGGACATGA54567–54585
    ORF32.SB-RGCTACCCAGGTGGTGTTGTT55006–54987
    ORF59ORF59.SB-FGTTCTGCGTCGAGGATGATG102042–102061
    ORF59.SB-RCGTTCAGCACCTCGGTCTAC102427–102408
    ORF81ORF81.SB-FAAAGCTCAACTGGCCAAGAG150809–150828
    ORF81.SB-RACACCGCCGTCTTCGAGTAG151259–151240
    ORF83ORF83.SB-FTGCTCTCCACGTCCTTGTA152838–152856
    ORF83.SB-RATGTCTCCTTTGTGCGGTC153480–153462
    ORF99ORF99.SB-FCCTCCAGACGCAGATCAACT184751–184770
    ORF99.SB-RCTTGAGGAAGGGCTGGTTG185204–185186
    ORF106ORF106.SB-FGCAGCAGCAGCAGAAGTG195783–195800
    ORF106.SB-RTCAGTTGGTCTTGGGGCC196013–195996
    ORF115ORF115.SB-FCTACGCCAACGACGAACC209426–209443
    ORF115.SB-RAGCACCACGAACCACACTC209776–209758
    ORF131ORF131.SB-FACTGGAGCGGGTGATAGTTG225487–225506
    ORF131.SB-RGGACTCGTCGTGCCTCTC225937–225920
PCR
    ORF25ORF25int_FATCAAGCGCTACGACGACTT45948–45967
    ORF25int_RTGTTGCAGGAGGTGTAGACG46442–46461
    ORF64ORF64int_FCCATAGTCCAGGACGACGAT121431–121450
    ORF64int_RTGCTGCTTGATGTTCTCCAC121919–121938
    ORF65ORF65int_FGATGGTCATGTTGGTGTTGC122996–123015
    ORF65int_RCCAAGAACGAGCTCTTCACC123494–123513
    ORF108ORF108int_FACCAACTACACGACCGTCTC201246–201265
    ORF108int_RCCGGGTTGGTGTAGGTAGAA201677–201696
    ORF132ORF132int_FTTGGTTTTTGTTGGTGACGA227468–227487
    ORF132int_RTGACGGGTTCCAAGATTAGC227936–227955
    ORF136ORF136int_FCTGGTTACATGGGTGGCTTT231360–231379
    ORF136int_RTAGCCCCTGTTGTAGGATGC231738–231757
    ORF148Pr148fw2GGTTGTTGGAGTAGTGGTGC254196–254215
    Pr148rev2CTCATTCAGGCTCGGAGAC254592–254610
    ORF149Pr149fw1GTAGTCGCTGGATGTGACG256662–256680
    Pr149rev1GTCAACACGGACTGCTCCG257093–257111
    ORF112ORF112intFWCCAGTGTCATCACCACAAGC205336–205355
    ORF112intREVACGGACATCCTGGGTATCAA205571–205590
qPCR
    CyHV-3 ORF89KHV-86FGACGCCGGAGACCTTGTGAF411803
KHV-163RCGGGTTCTTATTTTTGTCCTTGTT
KHV-109P(6FAM) CTTCCTCTGCTCGGCGAGCACG (BHQ1)
    Carp glucokinaseCgGluc-162FACTGCGAGTGGAGACACATGATAF053332
CgGluc-230RTCAGGTGTGGAGCGGACAT
CgGluc-185P(6FAM) AAGCCAGTGTCAAAATGCTGCCCACT (BHQ1)
  • a Coordinates are listed in relation to GenBank accession number NC_009127.1.

  • b Underlined: segments correspond to the CyHV-3 sequence; italicization indicates sequences corresponding to galK sequence. Mutated nucleotides are both underlined and italicized.