TABLE 1

Primers used for PRV, HSV-1, and human dUTPase cloning

Primer (restriction enzyme site)Sequence (5′–3′)
PRV-UL50-F (BglII)TATAGATCTGGCCCCTCGGTGGAGACGATG
PRV-UL50-R (HindIII)TATAAGCTTCGGGGTTGTCTGTGCCCAAT
PRV-UL50 1-197-R (HindIII)TTAAAGCTTTCACTGGATCCGGAAGCGGCA
PRV-UL50 1-225-R (HindIII)TTAAAGCTTTCAGATCCAGCCCAGCGGCTC
PRV-UL50 1-253-R (HindIII)TTAAAGCTTTCAGGCGACAAAGTCCCGCGC
PRV-UL50 D85N-FAACGGGATCGTGAACGCGGGCTTTCGC
PRV-UL50 D85N-RGCGAAAGCCCGCGTTCACGATCCCGTT
PRV-UL50 D133N-FAAGCGCGACGAGAACGCCGGATACGAC
PRV-UL50 D133N-RGTCGTATCCGGCGTTCTCGTCGCGCTT
HSV1-UL50-F (BamHI)ACGACGATGACAAGGGATCCATGAGTCAGTGGGGATCCGG
HSV1-UL50-R (HindIII)GGGCCATGGCGGCCAAGCTTCTAAATACCGGTAGAGCCAA
HSV1-UL50 D97A-FCTGGGTCTTATCGCATCGGGGTACCGC
HSV1-UL50 D97A-RGCGGTACCCCGATGCGATAAGACCCAG
Human-DUTPase-F (BamHI)CGCGGATCCATGCCCTGCTCTGAAGA
Human-DUTPase-R (HindIII)CCCAAGCTTTTAATTCTTTCCAGTGGA