Table 2.

Summary of oligonucleotide hybridization data used to locate SalHV-1 genes

Results of SalHV-1 hybridizationCorresponding CCV gene
Oligonucleotide probeaHybridizing SalHV-1 BamHI fragmentGeneSize of ORF (bp)Location in ORFb (bp)
GCAATAAACGCCTACTGTGCCCAAGGAGCA S251,4941,240
TATACTATGATCAACACTGGTGCAGAGAGC p27864268
ACACGACGCCGCCATGCGTTACAATACACG I372,0101,663
AAGAGGTTGTTTATCACCGTGGGATCTGTA i393,3691159
CTGACCAACCAACTGACTCAAGCGGCTCTG C464,0653,190
ATTGTCAGGGGGACCACCTACAGTTGTATA Z464,065604
CACTGGGGTGATTGATTCGGACTATAAAGG P49564369
GGCTTCAGGGGAGCCATCTTCCGGAGATTG A541,8211,003
CGAGGGGACTTTAAGATACAAGATATGGCA a563,5372,131
CCGAAAACTGGCGAATTGTCATTTAGAGGT t563,537106
AAAAGAGAGGCTGCATTTGACATAGAGACG X572,955604
TGTCATGTTGGTAAAAAACAGGTATGTTGA P572,9552,782
AAATTTCTCGCTCACGTTTTGGTTGACATG P581,797988
TGTGTGGTGATTGAACTCAAGACATACAAG A601,179655
ATACACCACTCAGACTTGGCTCACTTGGCT A601,179717
AAGGTCCACTTTCTGTCTTCTAGTCCACTG J621,2031,174
GCTATGCCGGATAAGTTTTCAGCACGCTAC J631,9861,228
GCCCACCGGATCATCTGGTTTAAACACCTG J641,5421,123
TTGGACCGAAACCATTACGAGCGGCTAGTG J654,3024,192
TGTGATCCTGTGTATGTGGGTCCGCTCACA c654,3022,068
GTGATTGATACAAGATTACTCTTTGGTTTA H674,6683,235
TCGTCCCTGGGCGTTTGCACCTTTGCGATA Q69558508
GTATATGCTGCAGTATGTGCCGTGGAGATG Q70681337
ATACTTGCCCTCGAGGAAATGCCGATCACC Q717951
TGCTGTGACATAATCCTATGTGACATTTGC e781,200397
  • a Hybridization data are given for 30-bp regions of randomly derived SalHV-1 sequences whose predicted translation products are related to CCV proteins. The list proceeds rightward along the CCV genome. Sequences correspond to the noncoding (upper) strand.

  • b Nucleotide in the CCV ORF which corresponds to the first residue of the oligonucleotide.